ID: 1185726074

View in Genome Browser
Species Human (GRCh38)
Location X:2422955-2422977
Sequence CACAAAAATTAGCTGGGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4755
Summary {0: 4, 1: 58, 2: 675, 3: 1374, 4: 2644}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185726074_1185726083 18 Left 1185726074 X:2422955-2422977 CCCAAGCCCAGCTAATTTTTGTG 0: 4
1: 58
2: 675
3: 1374
4: 2644
Right 1185726083 X:2422996-2423018 CTTCACCATGTTGGCCAGGCTGG 0: 1312
1: 91393
2: 161744
3: 174184
4: 162439
1185726074_1185726080 -5 Left 1185726074 X:2422955-2422977 CCCAAGCCCAGCTAATTTTTGTG 0: 4
1: 58
2: 675
3: 1374
4: 2644
Right 1185726080 X:2422973-2422995 TTGTGTTTTTAGGACAGTCAGGG 0: 1
1: 2
2: 143
3: 6294
4: 82784
1185726074_1185726082 14 Left 1185726074 X:2422955-2422977 CCCAAGCCCAGCTAATTTTTGTG 0: 4
1: 58
2: 675
3: 1374
4: 2644
Right 1185726082 X:2422992-2423014 AGGGCTTCACCATGTTGGCCAGG 0: 438
1: 31643
2: 122711
3: 181940
4: 190162
1185726074_1185726081 9 Left 1185726074 X:2422955-2422977 CCCAAGCCCAGCTAATTTTTGTG 0: 4
1: 58
2: 675
3: 1374
4: 2644
Right 1185726081 X:2422987-2423009 CAGTCAGGGCTTCACCATGTTGG 0: 1
1: 32
2: 1904
3: 39365
4: 93513
1185726074_1185726079 -6 Left 1185726074 X:2422955-2422977 CCCAAGCCCAGCTAATTTTTGTG 0: 4
1: 58
2: 675
3: 1374
4: 2644
Right 1185726079 X:2422972-2422994 TTTGTGTTTTTAGGACAGTCAGG 0: 1
1: 3
2: 337
3: 14154
4: 197060

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185726074 Original CRISPR CACAAAAATTAGCTGGGCTT GGG (reversed) Intronic
Too many off-targets to display for this crispr