ID: 1185727452 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:2433598-2433620 |
| Sequence | CAGTGAGAACACAGGGACGC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 35397 | |||
| Summary | {0: 1, 1: 23, 2: 1145, 3: 16650, 4: 17578} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1185727452_1185727456 | 9 | Left | 1185727452 | X:2433598-2433620 | CCTGCGTCCCTGTGTTCTCACTG | 0: 1 1: 23 2: 1145 3: 16650 4: 17578 |
||
| Right | 1185727456 | X:2433630-2433652 | TACTTGTAAGTGAGAACATGTGG | 0: 29 1: 509 2: 3270 3: 8785 4: 15469 |
||||
| 1185727452_1185727457 | 16 | Left | 1185727452 | X:2433598-2433620 | CCTGCGTCCCTGTGTTCTCACTG | 0: 1 1: 23 2: 1145 3: 16650 4: 17578 |
||
| Right | 1185727457 | X:2433637-2433659 | AAGTGAGAACATGTGGTGTTTGG | 0: 659 1: 7394 2: 15574 3: 20159 4: 11013 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1185727452 | Original CRISPR | CAGTGAGAACACAGGGACGC AGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||