ID: 1185727452

View in Genome Browser
Species Human (GRCh38)
Location X:2433598-2433620
Sequence CAGTGAGAACACAGGGACGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35397
Summary {0: 1, 1: 23, 2: 1145, 3: 16650, 4: 17578}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185727452_1185727456 9 Left 1185727452 X:2433598-2433620 CCTGCGTCCCTGTGTTCTCACTG 0: 1
1: 23
2: 1145
3: 16650
4: 17578
Right 1185727456 X:2433630-2433652 TACTTGTAAGTGAGAACATGTGG 0: 29
1: 509
2: 3270
3: 8785
4: 15469
1185727452_1185727457 16 Left 1185727452 X:2433598-2433620 CCTGCGTCCCTGTGTTCTCACTG 0: 1
1: 23
2: 1145
3: 16650
4: 17578
Right 1185727457 X:2433637-2433659 AAGTGAGAACATGTGGTGTTTGG 0: 659
1: 7394
2: 15574
3: 20159
4: 11013

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185727452 Original CRISPR CAGTGAGAACACAGGGACGC AGG (reversed) Intronic
Too many off-targets to display for this crispr