ID: 1185731176

View in Genome Browser
Species Human (GRCh38)
Location X:2463198-2463220
Sequence CTCCCTACTCAGAGAGGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1168
Summary {0: 1, 1: 0, 2: 4, 3: 142, 4: 1021}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185731173_1185731176 5 Left 1185731173 X:2463170-2463192 CCCAACTGAAGGTATTTTATTTT 0: 2
1: 0
2: 2
3: 78
4: 803
Right 1185731176 X:2463198-2463220 CTCCCTACTCAGAGAGGCTGTGG 0: 1
1: 0
2: 4
3: 142
4: 1021
1185731174_1185731176 4 Left 1185731174 X:2463171-2463193 CCAACTGAAGGTATTTTATTTTA 0: 2
1: 0
2: 5
3: 68
4: 645
Right 1185731176 X:2463198-2463220 CTCCCTACTCAGAGAGGCTGTGG 0: 1
1: 0
2: 4
3: 142
4: 1021

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185731176 Original CRISPR CTCCCTACTCAGAGAGGCTG TGG Intronic
900276181 1:1830374-1830396 CCAGCTACTCGGAGAGGCTGAGG - Intronic
900469302 1:2845110-2845132 TCAGCTACTCAGAGAGGCTGAGG + Intergenic
900476173 1:2877421-2877443 CTCCATCCTCCGAGAAGCTGGGG + Intergenic
900681043 1:3916481-3916503 ATCCCAATTCAGAGACGCTGGGG - Intergenic
900771782 1:4550925-4550947 CTGCTTCCTCTGAGAGGCTGAGG + Intergenic
901180697 1:7339845-7339867 CCCAGCACTCAGAGAGGCTGAGG - Intronic
901395088 1:8975385-8975407 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
901539771 1:9908487-9908509 CCAGCTACTCGGAGAGGCTGAGG - Intronic
901551486 1:9998521-9998543 CCAGCTACTCGGAGAGGCTGAGG - Intronic
901864029 1:12092292-12092314 CTAGCTACTCAGAAAGGCTGAGG - Intronic
902202093 1:14841288-14841310 CCAGCTACTCGGAGAGGCTGAGG + Intronic
902244885 1:15114303-15114325 CTCCCTGCTCAGGGAGGTTGAGG - Intronic
902451658 1:16500191-16500213 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
903043214 1:20547666-20547688 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
903147084 1:21381260-21381282 ATCCCTCCTCTGAGAAGCTGTGG + Intergenic
903232215 1:21928863-21928885 CCAGCTACTCAGGGAGGCTGAGG - Intronic
903351359 1:22718499-22718521 CCAGCTACTCAGGGAGGCTGAGG - Intronic
903681899 1:25102999-25103021 CTCCCTGATCAGAGAGTCTCAGG - Intergenic
903825394 1:26141192-26141214 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
903837377 1:26214028-26214050 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
903861442 1:26367148-26367170 CCAGCTACTCCGAGAGGCTGAGG + Intronic
904127533 1:28252134-28252156 CCCGCTACTCAGGGAGGCTGAGG - Intergenic
905024181 1:34838471-34838493 CTACCTACTCAGAGAGACCCCGG - Intronic
905052604 1:35064800-35064822 CCAGCTACTCGGAGAGGCTGAGG - Intronic
905200643 1:36314088-36314110 CCAGCTACTCGGAGAGGCTGAGG - Intronic
906034448 1:42741589-42741611 CTCCCAGCACAGAGAGCCTGAGG - Intergenic
906304734 1:44709720-44709742 CCAGCTACTCAGGGAGGCTGAGG + Intronic
906314002 1:44774648-44774670 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
906485888 1:46234777-46234799 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
906656165 1:47549767-47549789 CTCCCTTCCCAGAGAGACTGAGG + Intergenic
907176133 1:52524406-52524428 CCAGCTACTCGGAGAGGCTGAGG + Intronic
907265753 1:53259695-53259717 ATCCCAACACTGAGAGGCTGAGG - Intronic
907396451 1:54193722-54193744 CCCACTACTTTGAGAGGCTGAGG + Intronic
907688810 1:56642179-56642201 CTCAGTACTTTGAGAGGCTGAGG + Intronic
907716500 1:56931318-56931340 GTCCCTACTCACAGATGCAGGGG + Intronic
908109000 1:60876156-60876178 CCAGCTACTCAGAGAGGCTGAGG - Intronic
908540948 1:65121647-65121669 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
908548627 1:65187230-65187252 CCAGCTACTCGGAGAGGCTGAGG + Intronic
908856744 1:68438634-68438656 CTCCCTTCGCAGAGAAGATGGGG + Intronic
909075351 1:71046168-71046190 CCAGCTACTCGGAGAGGCTGAGG + Intronic
909144887 1:71917662-71917684 CCAGCTACTCGGAGAGGCTGAGG + Intronic
909617685 1:77630221-77630243 CTCAATACTCTGGGAGGCTGAGG + Intronic
909642566 1:77884724-77884746 CCAGCTACTCAGAGAAGCTGTGG + Intergenic
910753095 1:90655689-90655711 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
911214863 1:95181710-95181732 CCAGCTACTCAGGGAGGCTGAGG - Intronic
911619242 1:100048292-100048314 CCAGCTACTCAGAAAGGCTGAGG - Intronic
911842053 1:102695205-102695227 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
911976761 1:104507549-104507571 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
912275772 1:108256731-108256753 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
912292455 1:108437623-108437645 CCAGCTACTCAGGGAGGCTGAGG + Intronic
912353610 1:109037509-109037531 CCAGCTACTCAGAGAGGCTGAGG + Intronic
912399377 1:109376213-109376235 CCAGCTACTCGGAGAGGCTGAGG + Intronic
912524219 1:110268841-110268863 CCAGCTACTCAGAGAGGCTGAGG - Intronic
912525503 1:110279912-110279934 GTGCCTACTCGGGGAGGCTGAGG - Intronic
913102626 1:115583543-115583565 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
913224093 1:116683476-116683498 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
913257363 1:116965533-116965555 CTCACTGATTAGAGAGGCTGAGG - Intronic
914243649 1:145870204-145870226 CCAGCTACTCGGAGAGGCTGAGG - Intronic
915191196 1:154152284-154152306 CCAGCTACTCAGGGAGGCTGAGG - Intronic
915404355 1:155648053-155648075 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
915762194 1:158326083-158326105 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
916089126 1:161293361-161293383 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
917418675 1:174838800-174838822 CCAGCTACTCGGAGAGGCTGAGG + Intronic
917754120 1:178082518-178082540 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
917858463 1:179122039-179122061 CCACCTACTCAGAGAGGCTGAGG - Intronic
917956955 1:180109232-180109254 GCAGCTACTCAGAGAGGCTGAGG - Intronic
918676783 1:187296412-187296434 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
918769917 1:188544326-188544348 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
919912077 1:202117769-202117791 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
920018002 1:202928943-202928965 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
920348635 1:205322921-205322943 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
921147828 1:212376527-212376549 CTCCTTCCTCAGAGCTGCTGTGG + Intronic
921302621 1:213765227-213765249 CTCCCTAATCAGAAAGGGAGTGG - Intergenic
921365179 1:214366866-214366888 CCAGCTACTCGGAGAGGCTGAGG + Intronic
921567348 1:216736296-216736318 CCAGCTACTCGGAGAGGCTGAGG - Intronic
921636044 1:217494626-217494648 CCAGCTACTCAGGGAGGCTGAGG + Intronic
922222549 1:223619375-223619397 CTCGCTACTCAGAGAGTCCGGGG + Exonic
922449543 1:225725710-225725732 CCAGCTACTCAGCGAGGCTGAGG + Intergenic
922637780 1:227193182-227193204 CCAGCTACTCGGAGAGGCTGAGG - Intronic
922722966 1:227908000-227908022 CTGTCTACTCAGAGTGGCAGGGG - Intergenic
922874462 1:228929061-228929083 CTCCCCACTGCTAGAGGCTGGGG - Intergenic
923045238 1:230350775-230350797 CTCCCTCCTCACCGAGGCAGCGG - Intronic
923178324 1:231491285-231491307 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
923977187 1:239276527-239276549 CCTGCTACTCAGGGAGGCTGAGG + Intergenic
923977202 1:239276586-239276608 CCTGCTACTCAGGGAGGCTGAGG + Intergenic
924239416 1:242026813-242026835 CCAACTACTTAGAGAGGCTGAGG - Intergenic
924567418 1:245210268-245210290 CCACCTAGGCAGAGAGGCTGAGG - Intronic
924737320 1:246769747-246769769 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
1063072999 10:2685781-2685803 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1063391841 10:5654844-5654866 CTCACCACTTTGAGAGGCTGAGG + Intronic
1063438240 10:6051632-6051654 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1063467989 10:6260296-6260318 CTAGCTACACGGAGAGGCTGAGG + Intergenic
1063555828 10:7078711-7078733 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1063682075 10:8198273-8198295 CCAGCTACTCAAAGAGGCTGAGG + Intergenic
1063761607 10:9084774-9084796 TTTCCAACTCAGAGAGACTGTGG + Intergenic
1063990005 10:11550639-11550661 CCAACTACTCAGGGAGGCTGAGG + Intronic
1064194730 10:13235420-13235442 CCAGCTACTCAGAGAGGCTGAGG + Intergenic
1064204790 10:13313757-13313779 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1065039415 10:21676300-21676322 CTAGCTACTCGGAGAGGCTGAGG + Intronic
1065093048 10:22253251-22253273 CTCCCTACGCTGCGGGGCTGAGG - Intergenic
1065103191 10:22352043-22352065 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1065212349 10:23416397-23416419 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
1065440115 10:25744416-25744438 CTAGCTACTCAAGGAGGCTGAGG + Intergenic
1065911740 10:30312452-30312474 CCAGCTACTCAGAGAGGCTGAGG + Exonic
1066152572 10:32639741-32639763 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1066549542 10:36540803-36540825 ATCCCAACACTGAGAGGCTGAGG - Intergenic
1066995561 10:42559873-42559895 CTCAGCACTTAGAGAGGCTGAGG - Intergenic
1067103092 10:43347427-43347449 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
1067322216 10:45231814-45231836 CTCACCACTCTGGGAGGCTGAGG - Intergenic
1067378184 10:45747704-45747726 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1067731646 10:48817172-48817194 CTCCCTAACCAGAGGAGCTGAGG - Intronic
1067779622 10:49190337-49190359 CTCCCTGCTTAGACAGGCAGAGG + Intergenic
1067885885 10:50088379-50088401 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1068274493 10:54775768-54775790 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1068554507 10:58443950-58443972 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
1068690663 10:59910407-59910429 CCCCCTACTTTGGGAGGCTGAGG - Intergenic
1068977393 10:63024667-63024689 CTCAGAACTCTGAGAGGCTGAGG + Intergenic
1069044632 10:63729651-63729673 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
1069255160 10:66323534-66323556 CTAGCTACTCAAGGAGGCTGAGG + Intronic
1069486243 10:68825958-68825980 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1069653456 10:70069327-70069349 CTCCAGACTCAGAGAGGAAGAGG - Intronic
1070030399 10:72671065-72671087 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1070115803 10:73527747-73527769 CTCAGTACTCTGGGAGGCTGAGG + Intronic
1070176205 10:73972164-73972186 ATCCCAACACTGAGAGGCTGAGG - Intergenic
1070249543 10:74762046-74762068 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
1070462980 10:76688511-76688533 ATCCCAACACTGAGAGGCTGAGG + Intergenic
1070607887 10:77912084-77912106 CTAGCTACTCAGGGAGGCTGAGG + Intronic
1070653638 10:78255751-78255773 CTTCCTCCTAAGAAAGGCTGAGG - Intergenic
1070708621 10:78660255-78660277 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1070946003 10:80392209-80392231 CCAGCTACTCAGAGAGGCAGAGG + Intergenic
1071207533 10:83298437-83298459 CCAGCTACTCAGAGAGGCTGAGG + Intergenic
1071280446 10:84097163-84097185 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
1071829980 10:89362012-89362034 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1072354099 10:94589030-94589052 CTAGCTACTCAGGAAGGCTGAGG + Intronic
1072394504 10:95024945-95024967 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
1072589644 10:96817802-96817824 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1073126632 10:101154718-101154740 CTTCCCACTTTGAGAGGCTGAGG - Intergenic
1073304583 10:102492884-102492906 CCAGCTACTCAGGGAGGCTGAGG + Intronic
1073363170 10:102916995-102917017 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1073374485 10:103021235-103021257 CTCCTTCGTCAGGGAGGCTGTGG - Intronic
1073620624 10:105044116-105044138 CTCAGTACTTTGAGAGGCTGAGG + Intronic
1073651590 10:105366439-105366461 CTCCCCTTTCAGAGACGCTGTGG + Intergenic
1074131419 10:110581331-110581353 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1074456504 10:113600284-113600306 CCAGCTACTCTGAGAGGCTGAGG - Intronic
1074853134 10:117454607-117454629 CTCCCTGCTCAGGGAGGCAGGGG + Intergenic
1074988514 10:118679902-118679924 ATCCCAACACTGAGAGGCTGAGG - Exonic
1075296251 10:121278241-121278263 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
1075749380 10:124752862-124752884 CTCAACACTCTGAGAGGCTGAGG + Intronic
1075752279 10:124782695-124782717 CCAGCTACTCAGGGAGGCTGAGG + Intronic
1075791013 10:125084510-125084532 CTCCCTTCCCAGAGAGGATGGGG - Intronic
1075869198 10:125756925-125756947 CCAGCTACTCTGAGAGGCTGAGG - Intronic
1077260077 11:1612744-1612766 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
1077307744 11:1875578-1875600 CTCCCCAGGCAGAGAGGCTAGGG + Intronic
1077511318 11:2965117-2965139 CTTTCTCCTCAGAGAGGCTGAGG - Intronic
1077680244 11:4233296-4233318 CTCCACACTCAGGGTGGCTGTGG + Intergenic
1077681240 11:4242610-4242632 CTCCACACTCAGGGTGGCTGTGG - Intergenic
1077684523 11:4278715-4278737 CTCCACACTCAGGGTGGCTGTGG + Intergenic
1077685518 11:4288053-4288075 CTCCACACTCAGGGTGGCTGTGG - Intergenic
1077689654 11:4329873-4329895 CTCCCCACTCAGGGTGGCTGTGG + Intergenic
1077690671 11:4339214-4339236 CTCCACACTCAGGGTGGCTGTGG - Intergenic
1077854020 11:6103591-6103613 CTGCCCACACAGAGTGGCTGGGG - Intergenic
1078123126 11:8530803-8530825 CCAGCAACTCAGAGAGGCTGAGG - Intronic
1078287916 11:9976882-9976904 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1078347716 11:10565748-10565770 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1078513050 11:12000319-12000341 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1078592528 11:12657154-12657176 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1078694028 11:13611540-13611562 CAAGCTACTCAGGGAGGCTGAGG - Intergenic
1078786949 11:14503839-14503861 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1079508457 11:21182317-21182339 TCAGCTACTCAGAGAGGCTGAGG + Intronic
1079789664 11:24720812-24720834 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1080278223 11:30527038-30527060 CCAGCTACTCCGAGAGGCTGAGG - Intronic
1080304483 11:30821536-30821558 CTTCCAACTCAGTGAGGCTCAGG + Intergenic
1080312747 11:30913291-30913313 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1080391408 11:31850516-31850538 CTGCCTACTCAGGGAAGCCGAGG + Intronic
1080436116 11:32246271-32246293 CTCCACACTCTGGGAGGCTGGGG - Intergenic
1080436436 11:32249147-32249169 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
1080805538 11:35649712-35649734 CTAGCTACTCAGGGAGGCTGAGG + Intergenic
1081403070 11:42665292-42665314 ATCACTACTCAGAGTGGTTGAGG - Intergenic
1081464105 11:43300412-43300434 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
1081560763 11:44214227-44214249 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1081902192 11:46638320-46638342 CCAGCTACTCAGGGAGGCTGAGG + Intronic
1081992843 11:47346941-47346963 GTCCCCTCTCTGAGAGGCTGTGG - Intronic
1082702711 11:56453080-56453102 CTCCATTCTCAAGGAGGCTGTGG - Intergenic
1083280484 11:61624004-61624026 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1083569992 11:63754810-63754832 CCAGCTACTCAGAGAGGCTGAGG + Intronic
1083606643 11:63982824-63982846 CTCCCTTCCCTGAGAGGCAGAGG + Intronic
1083607904 11:63989897-63989919 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1084996006 11:72978970-72978992 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1085304042 11:75475249-75475271 CTCCCAACTCAGAGAAGCCTGGG - Intronic
1086110018 11:83189494-83189516 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
1087814807 11:102646890-102646912 CTCAGTACTTCGAGAGGCTGAGG - Intergenic
1088322966 11:108571931-108571953 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1088465917 11:110138670-110138692 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1088693022 11:112344009-112344031 CCCACTGCCCAGAGAGGCTGAGG + Intergenic
1089125905 11:116176407-116176429 CGCCCTCCTCAGAGAAGCTCTGG - Intergenic
1089512143 11:119006349-119006371 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1089546445 11:119230265-119230287 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1090622294 11:128571299-128571321 CCAGCTACTCTGAGAGGCTGAGG + Intronic
1091105620 11:132916803-132916825 CTCCCTTCACAGAGGGGCTGAGG + Intronic
1091471252 12:730088-730110 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
1091475709 12:770087-770109 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1091534008 12:1388232-1388254 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1091713929 12:2763013-2763035 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
1091964841 12:4730961-4730983 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1092126865 12:6080708-6080730 CTACCTGCTAAGAGAAGCTGAGG - Intronic
1092267022 12:6989423-6989445 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1092310625 12:7347651-7347673 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1092455981 12:8643301-8643323 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1092466123 12:8733766-8733788 CTAGCTACTCGGAGAGGCTGAGG + Intronic
1092581938 12:9851395-9851417 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1092836633 12:12495659-12495681 CTCTCTGTTCAGTGAGGCTGAGG + Intronic
1092980688 12:13791334-13791356 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1093696824 12:22170377-22170399 CCAGCTACTTAGAGAGGCTGAGG - Intronic
1093987484 12:25552489-25552511 CTAGCTACTCCGAGAGGCTGAGG + Intronic
1094259127 12:28471863-28471885 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1094549761 12:31439812-31439834 CCAGCTACTCAGGGAGGCTGAGG + Intronic
1094577061 12:31696359-31696381 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1094606260 12:31951728-31951750 CCAACTACTCAGGGAGGCTGAGG + Intergenic
1095358358 12:41305168-41305190 CTTCCTATTCAAAGTGGCTGAGG + Intronic
1095394276 12:41744425-41744447 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1095867259 12:46985359-46985381 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
1095895404 12:47275439-47275461 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1096196124 12:49649855-49649877 CTTCCTGCCCACAGAGGCTGAGG - Exonic
1096200799 12:49681314-49681336 CCAGCTACTCAGAGAGGCTGAGG - Intronic
1096238088 12:49943301-49943323 CTCCCTGCTCAGAGGAGCTGCGG - Intergenic
1096297658 12:50397503-50397525 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1096309591 12:50508819-50508841 CCAGCTACTCAGAAAGGCTGAGG - Intronic
1096383099 12:51175470-51175492 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1096383824 12:51181148-51181170 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
1096416598 12:51419789-51419811 CTCCAAACTGAGAGAGGCTCTGG - Intronic
1096642032 12:53002535-53002557 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1096704507 12:53410618-53410640 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1096769257 12:53923686-53923708 CTCCCTGCACAGATAGGGTGTGG + Intergenic
1096976505 12:55702293-55702315 CCAGCTACTCAGAGAGGCTGAGG - Intronic
1097001252 12:55878850-55878872 CCAGCTACTCAGAGAGGCTGAGG + Intergenic
1097003113 12:55895263-55895285 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
1097196881 12:57247547-57247569 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1097251936 12:57639318-57639340 CCAGCTACTCAGAGAGGCTAAGG + Intergenic
1097604802 12:61740321-61740343 CTCCCAACTCTGACAGGCTCCGG - Intronic
1098110369 12:67115244-67115266 CTCCGGACTTTGAGAGGCTGAGG + Intergenic
1098962838 12:76756897-76756919 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
1099121259 12:78691758-78691780 CTAGCTACTCAGGAAGGCTGAGG + Intergenic
1099323376 12:81179653-81179675 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1099337164 12:81377435-81377457 CCAGCTACTCAGAGAGGCCGAGG + Intronic
1099518719 12:83631806-83631828 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1099544726 12:83964182-83964204 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
1099979546 12:89582750-89582772 CTAGCTAGTCAGGGAGGCTGAGG + Intergenic
1100305644 12:93347666-93347688 CTCACCACTTTGAGAGGCTGAGG + Intergenic
1100461009 12:94799230-94799252 CTCATTCCTCAGTGAGGCTGAGG - Intergenic
1100536818 12:95519553-95519575 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1100683720 12:96961194-96961216 ATCCATACCCAGAAAGGCTGGGG + Intergenic
1100831267 12:98518405-98518427 CTTGCTACTCAGGGAAGCTGAGG - Intronic
1101376955 12:104179459-104179481 CACTTTACTCAGAGAGGGTGTGG + Intergenic
1102078664 12:110080361-110080383 CCACCTACTCGGGGAGGCTGAGG - Intergenic
1102141394 12:110618186-110618208 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1102383876 12:112490555-112490577 CTAACTACTCAGAGAGGCTGAGG - Intronic
1103083710 12:118045247-118045269 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1103105713 12:118223183-118223205 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1103332820 12:120166286-120166308 CCAGCTACTCAAAGAGGCTGAGG + Intronic
1103911170 12:124353263-124353285 CCACCTACTCAGACAGGCAGCGG - Intronic
1103962723 12:124619074-124619096 CCAGCTACTCAGTGAGGCTGAGG + Intergenic
1103990993 12:124799408-124799430 CTGGCTACTTAGGGAGGCTGAGG + Intronic
1104314321 12:127682863-127682885 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1104442541 12:128806052-128806074 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1104677941 12:130727773-130727795 CTCCATAGGGAGAGAGGCTGGGG + Intergenic
1104729069 12:131095041-131095063 CTCTCCACTCAGAGAGGCACAGG - Intronic
1104769250 12:131350686-131350708 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1104832100 12:131759684-131759706 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1105353473 13:19636592-19636614 CCATCTACTCCGAGAGGCTGAGG - Intronic
1105417843 13:20228597-20228619 CCAGCTGCTCAGAGAGGCTGAGG - Intronic
1105494002 13:20914285-20914307 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
1105640092 13:22253024-22253046 CTGGCTATTCAGGGAGGCTGAGG - Intergenic
1106083877 13:26523210-26523232 CTGCCTCCGCAGAGAGGCTGTGG - Intergenic
1106100783 13:26694117-26694139 CTCCTTCCTCACAGAGGCCGTGG + Intergenic
1106155653 13:27153079-27153101 CCCAGTACTCTGAGAGGCTGAGG + Intronic
1106839473 13:33671478-33671500 ATCCCAACACTGAGAGGCTGAGG + Intergenic
1107697169 13:43011642-43011664 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
1108006639 13:45953845-45953867 TTAGCTACTCAGGGAGGCTGAGG - Intergenic
1108324251 13:49314303-49314325 CTCCCCACCCAGACAGGCAGAGG - Intronic
1108367474 13:49730402-49730424 CCAGCTACTCAAAGAGGCTGAGG + Intronic
1108528911 13:51310562-51310584 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
1108609325 13:52068853-52068875 CCAGCTACTCAGGGAGGCTGAGG + Intronic
1108614151 13:52115126-52115148 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1108627990 13:52250810-52250832 CCACCTACTCAGAGGGGCTGAGG + Intergenic
1108658068 13:52555639-52555661 CCACCTACTCAGAGGGGCTGAGG - Intergenic
1108675969 13:52738635-52738657 GTCCCTGCTAAGAAAGGCTGTGG - Intronic
1109051979 13:57494816-57494838 CCAGCTACTCAGAGAGGCTGAGG + Intergenic
1109338448 13:61023321-61023343 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
1110580793 13:77122572-77122594 CCAGCTACTCAGAGAGGCTGAGG + Intronic
1110847165 13:80203051-80203073 CTCAGTACTCTGGGAGGCTGAGG - Intergenic
1111122555 13:83872418-83872440 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
1111258995 13:85710452-85710474 CTAGCTACTCAGGGATGCTGAGG - Intergenic
1111453246 13:88446816-88446838 CCACCTACTCAGGAAGGCTGAGG - Intergenic
1111585991 13:90285178-90285200 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1112054090 13:95674469-95674491 CTAGCTACTCAGGGAGACTGAGG - Intergenic
1112431031 13:99350405-99350427 CTCCCTAATCACAGAGGTTGGGG - Intronic
1112473438 13:99710037-99710059 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1112514778 13:100044121-100044143 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1112653152 13:101420035-101420057 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1113140841 13:107147403-107147425 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1113249058 13:108431187-108431209 CTGTCTACTGAGAGAGACTGAGG - Intergenic
1113362532 13:109644686-109644708 ATCCCAACTCTGGGAGGCTGAGG + Intergenic
1113362552 13:109644822-109644844 CCCAGCACTCAGAGAGGCTGAGG + Intergenic
1113484944 13:110646715-110646737 CCCCCTGCTCAGAGTGGCTTTGG - Intronic
1113731937 13:112647888-112647910 CCCACTACTCTGGGAGGCTGAGG - Intronic
1114323755 14:21568824-21568846 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
1114346762 14:21804477-21804499 CCAGCTACTCAGAGAGGCTGAGG + Intergenic
1114377691 14:22166113-22166135 CTCTCTGCTCAGAGTAGCTGAGG - Intergenic
1114431239 14:22663045-22663067 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1114460933 14:22885862-22885884 CTCCCTACCCAGAGTGTTTGTGG - Intronic
1114639864 14:24212500-24212522 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1114882203 14:26799800-26799822 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1114896089 14:26993227-26993249 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1115289042 14:31750288-31750310 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1115551821 14:34511838-34511860 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1115561742 14:34588881-34588903 CTCCCTCCTTTGGGAGGCTGAGG + Intronic
1116033479 14:39600678-39600700 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
1116231003 14:42216890-42216912 CCCACTACTCTGGGAGGCTGAGG + Intergenic
1116245848 14:42411003-42411025 CTCACTACTTTGGGAGGCTGAGG - Intergenic
1116419843 14:44720205-44720227 CTCCCACCTCAGAGTGGATGAGG + Intergenic
1116657027 14:47665867-47665889 CGCGCTCCTCAGGGAGGCTGAGG - Intronic
1118215612 14:63805500-63805522 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1118613577 14:67560140-67560162 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1118643715 14:67817602-67817624 CCAGCTACTCAGTGAGGCTGAGG - Intergenic
1118904321 14:70012525-70012547 CTTGCTTCTCAGAGAAGCTGTGG - Intronic
1119132783 14:72190185-72190207 CTCCCTAGGGAGAGAGGCTCAGG - Intronic
1119313306 14:73669231-73669253 CTAGCTACTCAGGGAGGCTGAGG - Intronic
1119718836 14:76877450-76877472 CCAACTACTCGGAGAGGCTGAGG + Intergenic
1120163143 14:81166955-81166977 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
1120562929 14:86018776-86018798 CTCCCTACTCCCAGTGGCAGTGG - Intergenic
1120608266 14:86606592-86606614 CTCAGAACTCTGAGAGGCTGGGG - Intergenic
1120677812 14:87442185-87442207 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
1120778509 14:88463961-88463983 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1121021800 14:90584781-90584803 CTCCCTAAAGAGAGATGCTGTGG + Intronic
1121154714 14:91671902-91671924 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1121323760 14:93007855-93007877 CTTCCTCCTCAGAGAGCTTGGGG + Intronic
1121769301 14:96518522-96518544 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1122434481 14:101685160-101685182 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1122559274 14:102600200-102600222 CCAGCTACTCAGAGAGGCTGAGG - Intronic
1122589274 14:102834570-102834592 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1122730395 14:103792954-103792976 CCAGCTACTCAGGGAGGCTGAGG + Intronic
1122876538 14:104668799-104668821 CTCCCCACTTTGAAAGGCTGTGG - Intergenic
1123109003 14:105856585-105856607 CTCCCTGCTCAGAATGGCTGAGG + Intergenic
1123432369 15:20229580-20229602 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
1123668076 15:22625452-22625474 ATCCCAACTCTGGGAGGCTGAGG + Intergenic
1123760275 15:23426404-23426426 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
1123981654 15:25610232-25610254 TTCCCTCCACACAGAGGCTGTGG + Intergenic
1123997701 15:25730184-25730206 CCAGCTACTCAGGGAGGCTGAGG + Intronic
1124001038 15:25760080-25760102 ATAGCTACTCAGGGAGGCTGAGG - Intronic
1124080401 15:26489262-26489284 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1124340416 15:28886408-28886430 CTCCCGACTCAGCGTGGCTGCGG + Intronic
1125020101 15:34975942-34975964 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
1125555833 15:40583895-40583917 CCACCTACTCCGAGAGGCTGAGG - Intergenic
1125618028 15:41033447-41033469 CTCTCTACTCAAGGAGGCTGAGG - Intronic
1126778945 15:52121716-52121738 CCAGCTACTCGGAGAGGCTGAGG - Exonic
1127228541 15:56962015-56962037 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1127421938 15:58814891-58814913 CTCGGCACTCTGAGAGGCTGAGG - Intronic
1128123033 15:65168970-65168992 CTGGATACTCAGGGAGGCTGAGG - Intronic
1128277247 15:66363865-66363887 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1128340257 15:66817671-66817693 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
1128472666 15:67968239-67968261 CTCCAGACGCAGAGAAGCTGTGG + Intergenic
1128479427 15:68024433-68024455 CCAGCTACTCTGAGAGGCTGAGG + Intergenic
1129098156 15:73231617-73231639 CTAGCTGCTCAGGGAGGCTGAGG + Intronic
1129109057 15:73327220-73327242 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1129173056 15:73819620-73819642 ATCCCTACACTGGGAGGCTGAGG - Intergenic
1129320941 15:74774492-74774514 CCAGCTACTCTGAGAGGCTGAGG + Intergenic
1129448188 15:75633572-75633594 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1129502807 15:76056340-76056362 CCAGCTACTCAGGGAGGCTGAGG + Intronic
1129593912 15:76944106-76944128 CCAGCTACTCAGAGAGGCTGAGG - Intronic
1129647512 15:77450243-77450265 CTAGCTACTCGGGGAGGCTGAGG - Intronic
1129699415 15:77759025-77759047 CTCCTTACTCAGGGAGGGTGGGG - Intronic
1129747106 15:78030415-78030437 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1130247399 15:82264184-82264206 CCAGCTACTCAGAGAGGCTGAGG - Intronic
1130289302 15:82582855-82582877 CGAGCTACTCAGGGAGGCTGAGG - Intronic
1131046718 15:89321244-89321266 CTGCCTACTCGGTCAGGCTGTGG + Exonic
1131240974 15:90743109-90743131 CCAACTACTCAGGGAGGCTGAGG - Intronic
1131271872 15:90952533-90952555 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1131491675 15:92868560-92868582 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1131648998 15:94378405-94378427 CTAGCTAGTCATAGAGGCTGAGG + Intronic
1131965217 15:97834946-97834968 AGCCCTTCTCAGAGAAGCTGAGG - Intergenic
1131979460 15:97981006-97981028 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1131992071 15:98102310-98102332 CTGGCTACTCAGGGAGGCTGAGG - Intergenic
1132839767 16:1973312-1973334 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1132893186 16:2214532-2214554 CTGCCTACGCCGAGAAGCTGCGG - Exonic
1132909865 16:2303920-2303942 CTCTGCACTCAGAGAGGCGGCGG + Intronic
1132946916 16:2536903-2536925 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
1133045767 16:3087518-3087540 CTCCTTCCTCAGGAAGGCTGGGG - Intergenic
1133092443 16:3414645-3414667 CCAGCTACTCAGGGAGGCTGAGG + Intronic
1133125316 16:3642407-3642429 CTCCTTCCTCAGAGAGGCCTTGG + Intronic
1133196365 16:4173635-4173657 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1134110856 16:11514653-11514675 TTCCCCACTCAGCGAGGCTGGGG + Intronic
1134150718 16:11802583-11802605 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
1134283753 16:12841830-12841852 ATCCCAGCTCAGGGAGGCTGAGG - Intergenic
1134448611 16:14349279-14349301 ATCCCCACTCTGGGAGGCTGAGG + Intergenic
1134641870 16:15835867-15835889 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1134646563 16:15872457-15872479 CCCCACACTCTGAGAGGCTGAGG + Intronic
1135525101 16:23208229-23208251 CCAGCTACTCAGAGAGGCTGAGG + Intronic
1135537883 16:23308270-23308292 CCCAGCACTCAGAGAGGCTGAGG + Intronic
1135951178 16:26915873-26915895 GTTCTTACTCATAGAGGCTGAGG - Intergenic
1135983132 16:27164153-27164175 CTTGCTACTCAGGGAGGCTGAGG - Intergenic
1136012270 16:27371550-27371572 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
1136156250 16:28384267-28384289 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1136206836 16:28731020-28731042 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1136492526 16:30618633-30618655 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1136525436 16:30826642-30826664 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1136571224 16:31098176-31098198 CCCCATACTTTGAGAGGCTGAGG - Intergenic
1136852273 16:33621560-33621582 CCAGCTACTCAGAGAGGCTGAGG + Intergenic
1137085196 16:36112009-36112031 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1137234202 16:46600348-46600370 CTCACTACTCAAGGAGGCTAAGG + Intronic
1137639963 16:50020201-50020223 CCCACTACTCAGGGAGGCCGAGG + Intergenic
1138249541 16:55491394-55491416 TTACCTCTTCAGAGAGGCTGAGG + Intronic
1138621647 16:58216264-58216286 CTAGCTACTCGGAGAGGCTGAGG - Intergenic
1138628384 16:58272128-58272150 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1138754625 16:59468490-59468512 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1139119473 16:63998093-63998115 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
1139154459 16:64423737-64423759 CCACCTACTCGGGGAGGCTGAGG + Intergenic
1139495173 16:67311551-67311573 ATCCCAACTCTGGGAGGCTGAGG - Intronic
1140036938 16:71378260-71378282 ATCCCTACTCAAGGAGGCTAAGG + Intronic
1140230532 16:73113908-73113930 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1140243992 16:73231862-73231884 CTGCCTACTCATCGAGGCTAAGG - Intergenic
1140906441 16:79413356-79413378 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1141499089 16:84431378-84431400 CCAGCTACTCAGGGAGGCTGAGG + Intronic
1141956457 16:87375189-87375211 CCACCTACTTGGAGAGGCTGAGG + Intronic
1142132015 16:88435498-88435520 CTCCTTCCACAGAGAGGCAGTGG - Exonic
1142166182 16:88590200-88590222 CCCCATACTCTGGGAGGCTGAGG - Intronic
1142240696 16:88943495-88943517 CTCCCTACTCAGGAGAGCTGTGG + Intronic
1203113868 16_KI270728v1_random:1470031-1470053 CCAGCTACTCAGAGAGGCTGAGG + Intergenic
1142467435 17:144372-144394 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1142649559 17:1339071-1339093 CTCAGTGCTCAGAGAGGCTGAGG + Intergenic
1142658430 17:1410440-1410462 CCCACCACTCTGAGAGGCTGAGG - Intergenic
1142727968 17:1830174-1830196 CTCTCTACTCCGCGAGGCTCGGG - Intronic
1142848788 17:2694554-2694576 CTCCCTCCTCAGTGAGACCGTGG - Exonic
1143073216 17:4315920-4315942 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1143653321 17:8277820-8277842 CCAGCTACTCAGAAAGGCTGAGG + Intergenic
1143724185 17:8834039-8834061 CCAGCTACTCAGAGAGGCTGAGG + Intronic
1143956144 17:10671003-10671025 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1144143029 17:12368548-12368570 CCACCTACTCAGGGAGGCTGAGG - Intergenic
1144184418 17:12783228-12783250 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
1144199697 17:12929066-12929088 CTCTCTACTGGGACAGGCTGGGG + Intronic
1144328568 17:14204849-14204871 CTCTGTACTTTGAGAGGCTGAGG + Intronic
1144409728 17:14988833-14988855 CCAGCTACTCAGAGAGGCTGAGG + Intergenic
1145111691 17:20169121-20169143 CTCAGTACTTTGAGAGGCTGAGG - Intronic
1145296272 17:21594442-21594464 TTCCCTTGTCAAAGAGGCTGAGG + Intergenic
1146317287 17:31818089-31818111 CCAGCTACTCAAAGAGGCTGAGG - Intergenic
1146319688 17:31837120-31837142 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
1146736937 17:35246461-35246483 CCCCCTCCTCTGACAGGCTGGGG + Intronic
1146775780 17:35614438-35614460 CTCAGTACTTTGAGAGGCTGAGG - Intronic
1146887199 17:36480152-36480174 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1147262851 17:39218795-39218817 CTCAGCACTCTGAGAGGCTGAGG + Intronic
1147297890 17:39499321-39499343 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1147424519 17:40339669-40339691 CTCCCTACTTAGAATGCCTGTGG + Intronic
1147462871 17:40585868-40585890 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1147614196 17:41818838-41818860 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1147708673 17:42447106-42447128 CCAGCTACTCAGAGAGGCTGAGG + Intergenic
1147777099 17:42909976-42909998 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1147909285 17:43845567-43845589 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1148005251 17:44422603-44422625 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1148325449 17:46780659-46780681 CCAGCTACTCAGAGAGGCTGAGG + Intronic
1148731345 17:49838659-49838681 CTCCCCAGGCAGAGAGGATGAGG - Exonic
1148897033 17:50844898-50844920 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1148923459 17:51060960-51060982 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1149038329 17:52158757-52158779 TTCCCAACTCAGAGAGGAGGAGG + Intronic
1149585543 17:57783592-57783614 CCCCCAACCCAGAGGGGCTGCGG - Intergenic
1149675028 17:58452132-58452154 CTAGCTACTCAGGAAGGCTGAGG + Intronic
1149715491 17:58785415-58785437 CTAGCTACTCTGGGAGGCTGAGG - Intronic
1149738006 17:59014959-59014981 CTGGCTACTTGGAGAGGCTGAGG + Intronic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1150110945 17:62498976-62498998 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1150316289 17:64171863-64171885 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1150327093 17:64265905-64265927 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1151198092 17:72446028-72446050 CTCCCTAGGCAGAGGGTCTGTGG + Intergenic
1151332128 17:73416310-73416332 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1151631300 17:75312893-75312915 CCAGCTACTCAAAGAGGCTGAGG - Intergenic
1151675585 17:75595785-75595807 CTGCCAACTGAGAGAGACTGGGG - Intergenic
1152113966 17:78373438-78373460 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
1152114408 17:78376620-78376642 CTAGCTACTCAGGAAGGCTGAGG - Intergenic
1152164356 17:78692569-78692591 CTCTCTTCTCAGAGAGGGTTGGG + Intronic
1152387296 17:79982392-79982414 CCCCCTACTTTGGGAGGCTGAGG - Intronic
1152387540 17:79983980-79984002 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1153026952 18:680959-680981 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1153937607 18:9943974-9943996 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1155131510 18:22939389-22939411 CCCGCTACTCAGGAAGGCTGAGG + Intronic
1155133111 18:22958790-22958812 CTCAGTACTCTGGGAGGCTGAGG - Intronic
1155427742 18:25723975-25723997 CTCCCTGCAGAGAGGGGCTGTGG + Intergenic
1155565938 18:27134169-27134191 CTCTCTCATCAGAGAGGCTCAGG + Intronic
1155740405 18:29281883-29281905 TTCCCTGCTCAGGGAGGCTCTGG - Intergenic
1155856078 18:30836536-30836558 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1156643854 18:39135821-39135843 CTCTCTACTGAGAGAGATTGGGG + Intergenic
1157147697 18:45181370-45181392 CTCCCTGCTCAGGGTGGCAGAGG + Intergenic
1157798013 18:50593485-50593507 CTCTCTGCTCAGAAAGACTGCGG - Intronic
1157986631 18:52446045-52446067 CCAGCTACTCAGAGAGGCTGAGG - Intronic
1158054428 18:53261624-53261646 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1158590225 18:58772835-58772857 CTCCCTTCTGAGAGAGGAGGTGG - Intergenic
1158720209 18:59917915-59917937 CTCAGTACTCTGGGAGGCTGAGG + Intergenic
1158902071 18:61973267-61973289 CTGCCGAATCAGAGATGCTGAGG + Intergenic
1159106035 18:64002758-64002780 CTACCTCCTGGGAGAGGCTGGGG - Intronic
1159381607 18:67667107-67667129 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1159658720 18:71065406-71065428 CCAGCTACTCAGAGAGGCTGAGG + Intergenic
1159955877 18:74518144-74518166 CCAGCTGCTCAGAGAGGCTGAGG + Intronic
1160713897 19:566303-566325 CCAGCTACTCAGAGAGGCTGAGG + Intergenic
1160802973 19:979039-979061 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
1161049479 19:2155243-2155265 CCATCTACTCAGGGAGGCTGAGG + Intronic
1161110814 19:2468977-2468999 CCAGCTACTCCGAGAGGCTGAGG - Intergenic
1161226284 19:3147770-3147792 CCAGCTACTCAGAGAGGCTGAGG + Intronic
1161344013 19:3758969-3758991 CTCAGTACTCTGGGAGGCTGAGG + Intronic
1161584164 19:5096199-5096221 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1161819862 19:6523397-6523419 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
1162022241 19:7873268-7873290 CTCCCCTCTCCCAGAGGCTGGGG + Exonic
1162049492 19:8024177-8024199 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1162075266 19:8182532-8182554 CCAGCTACTCAGGGAGGCTGAGG + Intronic
1162216010 19:9134696-9134718 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1162216067 19:9135082-9135104 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1162369962 19:10272678-10272700 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1162436519 19:10663318-10663340 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1162512129 19:11125712-11125734 CTAGCTACTCCCAGAGGCTGAGG + Intronic
1162553290 19:11370468-11370490 CCCAGCACTCAGAGAGGCTGAGG + Intergenic
1162587257 19:11567758-11567780 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1162616244 19:11803095-11803117 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1162776042 19:12980075-12980097 CTCCCTGCTCTGAGAGTCTCTGG - Intergenic
1162870679 19:13584222-13584244 TTCAGTGCTCAGAGAGGCTGTGG + Intronic
1162966533 19:14158863-14158885 CTCACAGCTCAGAGAGGATGGGG - Intronic
1163343071 19:16722402-16722424 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1163464225 19:17456932-17456954 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1163464371 19:17458333-17458355 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1163565363 19:18048047-18048069 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1163590150 19:18188727-18188749 CCAGTTACTCAGAGAGGCTGAGG - Intergenic
1163751864 19:19082931-19082953 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1163884626 19:19954988-19955010 CTCAGCACTCTGAGAGGCTGAGG - Intergenic
1164056396 19:21625594-21625616 CTAGGTACTCAGGGAGGCTGAGG - Intergenic
1164309865 19:24036175-24036197 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1165028595 19:32980951-32980973 CCAGCTACTCAGAGAGGCTGAGG - Intronic
1165083139 19:33322622-33322644 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
1165537472 19:36461553-36461575 CCAGCTACTCAGGGAGGCTGAGG + Intronic
1165552574 19:36601216-36601238 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1165632962 19:37317299-37317321 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1165637842 19:37358258-37358280 CCAGCTACTCAGAGAGGCTGAGG - Intronic
1165681217 19:37777906-37777928 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1165697436 19:37911624-37911646 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1166151203 19:40876986-40877008 CTCCCGACACAAAGAGTCTGGGG + Intronic
1166161984 19:40960850-40960872 CTCCCAACTCAGCTGGGCTGAGG + Intergenic
1166193265 19:41190086-41190108 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1166372088 19:42307549-42307571 TCACCTACTCAAAGAGGCTGAGG - Intronic
1166540883 19:43604989-43605011 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1166704120 19:44899015-44899037 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1166801397 19:45459771-45459793 CCAGCTACTCAGGGAGGCTGAGG + Intronic
1166837236 19:45674919-45674941 CTCCCAACTCAGATAAACTGTGG - Intronic
1166977194 19:46611654-46611676 CCTCCTACTTTGAGAGGCTGAGG + Intergenic
1167342839 19:48926067-48926089 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
1167438561 19:49494699-49494721 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
1167513805 19:49911017-49911039 CTAGCTACTCTGGGAGGCTGAGG - Intronic
1167558650 19:50211729-50211751 CTCAGTACTTTGAGAGGCTGAGG + Intronic
1167889082 19:52525781-52525803 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1168002372 19:53459368-53459390 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
1168188320 19:54716478-54716500 CTCACTTCTCAGAGTGGTTGTGG - Intergenic
1168373266 19:55854220-55854242 CCCAATACTTAGAGAGGCTGAGG - Intronic
1168379129 19:55905535-55905557 CCAGCTACTCAGAAAGGCTGAGG + Intronic
1168612325 19:57811286-57811308 CCAGCTACTCGGAGAGGCTGAGG - Intronic
925174219 2:1770939-1770961 CACGCTACTCACTGAGGCTGCGG + Intergenic
925267768 2:2579139-2579161 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
925800126 2:7590896-7590918 CTTCCTTATCAGAAAGGCTGGGG + Intergenic
925884967 2:8387440-8387462 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
926255398 2:11189874-11189896 CCACCTACTCTGGGAGGCTGAGG + Intronic
926618244 2:15021115-15021137 CCATCTACTCAGGGAGGCTGAGG + Intergenic
927572482 2:24171890-24171912 CTAGCTACTCAGAAAAGCTGAGG + Intronic
927593818 2:24379762-24379784 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
927690238 2:25203113-25203135 CCACCTACTTGGAGAGGCTGAGG - Intergenic
927962094 2:27247270-27247292 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
928129434 2:28638946-28638968 CCAGCTACTCAGGGAGGCTGAGG + Intronic
928526266 2:32144633-32144655 CTCACTACTTTGGGAGGCTGTGG + Intronic
928554835 2:32413122-32413144 CCAGCTACTCAGGGAGGCTGAGG - Intronic
928955488 2:36862848-36862870 CCAGCTACTCGGAGAGGCTGAGG - Intronic
929159144 2:38814186-38814208 CTCAGTACTTTGAGAGGCTGAGG - Intronic
929224250 2:39496650-39496672 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
929606420 2:43237511-43237533 CCAGCTACTCAGGGAGGCTGAGG - Intronic
930007970 2:46913295-46913317 CTCAATACTTTGAGAGGCTGAGG + Intronic
930225029 2:48783521-48783543 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
931350582 2:61484741-61484763 CCAGCTACTCGGAGAGGCTGAGG - Intronic
931497056 2:62819503-62819525 ATCCCAACACTGAGAGGCTGAGG + Intronic
931708110 2:64964674-64964696 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
932355119 2:71061980-71062002 ATCCCTACTCAGGGGGGCTGAGG + Intergenic
932794577 2:74683211-74683233 CTGTCTAGTCAGGGAGGCTGAGG + Intronic
933874646 2:86606891-86606913 CTAGCTACTCAAGGAGGCTGAGG - Intronic
934563997 2:95328401-95328423 AGGCCCACTCAGAGAGGCTGTGG + Intronic
934658142 2:96127687-96127709 CCACCTACTCAGGGAGGCTGAGG - Intronic
934694467 2:96389247-96389269 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
934754295 2:96814811-96814833 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
934855774 2:97728865-97728887 CCAGCTACTCAGGGAGGCTGAGG - Intronic
934999576 2:99000392-99000414 TCACCTACTCAGGGAGGCTGAGG + Intronic
935403850 2:102687892-102687914 CCAGCTACTCAGGGAGGCTGAGG - Intronic
936043039 2:109164296-109164318 CTAGCTACTCAGGGAGGCTGAGG - Intronic
936049387 2:109211758-109211780 CCAGCTACTCAGGGAGGCTGAGG - Intronic
936094395 2:109520814-109520836 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
936094437 2:109521100-109521122 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
936388500 2:112052672-112052694 CTGGCTACTCAAAGAAGCTGAGG - Intergenic
937562300 2:123240801-123240823 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
937566238 2:123292636-123292658 CTAGCTACTCAGGGAGGCTGAGG - Intergenic
937869211 2:126775858-126775880 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
938079443 2:128361853-128361875 CTCCCTGCTCAAGGAAGCTGGGG - Intergenic
938395188 2:130940714-130940736 CCAGCTACTCGGAGAGGCTGAGG + Intronic
938734842 2:134176455-134176477 CTAGCTACTCAGGGAGGCTGAGG + Intronic
938819133 2:134936636-134936658 CCACCTTCTCAGGGAGGCTGAGG + Intronic
938986919 2:136585477-136585499 CAAGCTACTCGGAGAGGCTGAGG - Intergenic
939257723 2:139765885-139765907 CTCAGTACTTTGAGAGGCTGAGG + Intergenic
939259540 2:139789572-139789594 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
939872166 2:147537844-147537866 CCAGCTACTCAGAGAGGCTGAGG + Intergenic
939888400 2:147706442-147706464 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
939896294 2:147795237-147795259 CTCAGGACTCTGAGAGGCTGAGG + Intergenic
940350425 2:152679964-152679986 CCAGCTACTCAGAGAGGCTGAGG - Intronic
940855201 2:158723972-158723994 CTGCCTTCTCTGAGGGGCTGGGG - Intergenic
942057676 2:172199728-172199750 CTAGCTAATCGGAGAGGCTGAGG - Intergenic
942326697 2:174782125-174782147 ATCCCGACTCAGACCGGCTGCGG - Intergenic
942566282 2:177267308-177267330 CCAGCTACTCAGGGAGGCTGAGG + Intronic
942569291 2:177297144-177297166 CTCACTACTTTGAGAGGCTGAGG - Intronic
942700284 2:178699840-178699862 CCAGCTACTCAGAGAGGCTGAGG - Intronic
944087654 2:195868209-195868231 CCAGCTACTCAGAGAGGCTGAGG - Intronic
944088968 2:195883330-195883352 CCAGCTACTCGGAGAGGCTGAGG + Intronic
944445604 2:199785361-199785383 CCAGCTACTCGGAGAGGCTGAGG - Intronic
944647405 2:201793309-201793331 CCAGCTACCCAGAGAGGCTGAGG + Intronic
944700559 2:202242308-202242330 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
944827673 2:203501942-203501964 CCAGCTACTCAGGGAGGCTGAGG - Intronic
944909482 2:204295899-204295921 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
945230527 2:207584517-207584539 CTGACTACTCAGGGAGGCTGAGG - Intronic
945253467 2:207784180-207784202 CCCCCAACTTAGAGAGGCTGAGG + Intergenic
945291715 2:208133901-208133923 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
946850071 2:223897492-223897514 CCAGCTACTCAGGGAGGCTGAGG - Intronic
946925132 2:224618903-224618925 CCAGCTACTCAGAGAGACTGAGG + Intergenic
947417142 2:229908615-229908637 CCAGCTACTCGGAGAGGCTGAGG + Intronic
947617025 2:231564568-231564590 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
947747472 2:232516358-232516380 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
948149895 2:235736723-235736745 CCAGCTACTCAGGGAGGCTGAGG + Intronic
948313377 2:237007342-237007364 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
948596464 2:239082605-239082627 CTCCTTCCTGACAGAGGCTGAGG - Intronic
948902479 2:240963548-240963570 CTCCCCAGGCTGAGAGGCTGCGG + Intronic
1168751076 20:281849-281871 CCAACTACTCCGAGAGGCTGAGG + Intronic
1169020497 20:2327359-2327381 CCAGCTACTGAGAGAGGCTGAGG + Intronic
1169750699 20:8990456-8990478 CTAGCTACTTAGGGAGGCTGGGG + Intergenic
1169826497 20:9774197-9774219 CTCCCTACTGAAAGAGCTTGGGG + Intronic
1169879578 20:10331888-10331910 CTAGCTACTCAAGGAGGCTGAGG - Intergenic
1170239346 20:14146201-14146223 CCAGCTACTCAGAGAGGCTGAGG + Intronic
1170552568 20:17490188-17490210 CTCTCTACCCAGTGATGCTGGGG - Intergenic
1170936355 20:20813433-20813455 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1170988637 20:21281863-21281885 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1171132067 20:22663243-22663265 CTCCCTAATCAGAGGTGATGGGG - Intergenic
1171303955 20:24088995-24089017 CCACTTACTCGGAGAGGCTGAGG - Intergenic
1171478610 20:25434695-25434717 ATCCCAACACTGAGAGGCTGAGG - Intronic
1171996389 20:31734928-31734950 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
1172242652 20:33423529-33423551 CTTCCTCCTCAGGGAAGCTGAGG + Intronic
1172368299 20:34366336-34366358 CCAGCTACTCAGGGAGGCTGGGG - Intronic
1172439046 20:34952548-34952570 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1172498180 20:35404252-35404274 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1172940402 20:38650024-38650046 CTCTCCACTCAGAGGGGATGAGG + Exonic
1172956038 20:38759913-38759935 ATCCCAACACTGAGAGGCTGAGG + Intronic
1173402657 20:42738951-42738973 CCAGCTACTCAAAGAGGCTGAGG + Intronic
1173513424 20:43648281-43648303 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1173918976 20:46729755-46729777 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1173935233 20:46856036-46856058 ATCCCAACACTGAGAGGCTGAGG + Intergenic
1173985933 20:47261421-47261443 CTAGCTACTCAGGGAGGGTGAGG + Intronic
1174269151 20:49354415-49354437 CTCAGTACTTTGAGAGGCTGAGG + Intergenic
1174270203 20:49362788-49362810 CTCTGTACTTTGAGAGGCTGAGG + Intergenic
1175273598 20:57752403-57752425 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1175437060 20:58960643-58960665 CTCCGTACTTTGGGAGGCTGAGG + Intergenic
1176040385 20:63062396-63062418 CTCTCTGCTCAGAGAGCCGGGGG + Intergenic
1176205604 20:63886474-63886496 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1176308068 21:5134742-5134764 CTCCCCACTGCGAGAGGATGGGG + Intronic
1176376805 21:6090798-6090820 CTCCCAGCCCTGAGAGGCTGGGG - Intergenic
1176942474 21:14940571-14940593 CTTCCTTCTTAGAGAGGGTGAGG + Intergenic
1176975962 21:15322406-15322428 CTCAGCACTTAGAGAGGCTGAGG + Intergenic
1177052170 21:16249999-16250021 CTCAGTACTTTGAGAGGCTGAGG - Intergenic
1177580819 21:23020399-23020421 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
1178557348 21:33604238-33604260 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1178570876 21:33735887-33735909 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1178683159 21:34690181-34690203 CTCACAGCTCAGAGAGGGTGAGG + Intronic
1178839559 21:36127931-36127953 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1178901178 21:36600358-36600380 TTCCACACTCTGAGAGGCTGAGG - Intergenic
1179030463 21:37715435-37715457 CTCCCAACTCTGAGATGCTGTGG + Intronic
1179107192 21:38412483-38412505 CTCCCTACTTAGGGAGGCTGTGG + Intronic
1179344053 21:40539378-40539400 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1179501433 21:41811797-41811819 CCAGCTACTCAGAGAGGCTGAGG - Intronic
1179501499 21:41812149-41812171 CTCCCTACTCTGGGAGGCTCTGG - Intronic
1179746670 21:43447446-43447468 CTCCCAGCCCTGAGAGGCTGGGG + Intergenic
1179848992 21:44127290-44127312 CTCCCCACTGCGAGAGGATGGGG - Intronic
1180110923 21:45650074-45650096 ATCCCAACACTGAGAGGCTGAGG + Intronic
1180183576 21:46128763-46128785 CTCACATCCCAGAGAGGCTGAGG + Intronic
1180616800 22:17133683-17133705 CCCCCTTCTCAGTGGGGCTGAGG + Intergenic
1180751902 22:18130536-18130558 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1180900303 22:19366874-19366896 CTAGCTACTCGGGGAGGCTGAGG - Intronic
1181036457 22:20171958-20171980 GGCCCTGCTCAGAGAGGCTGTGG - Intergenic
1181303225 22:21897195-21897217 CCAGCTACTCTGAGAGGCTGAGG - Intergenic
1181472199 22:23147443-23147465 CTAGCTACTCCGGGAGGCTGAGG - Intronic
1181815804 22:25436044-25436066 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
1181825021 22:25507962-25507984 CTCCCTAAACAGACAGGATGGGG + Intergenic
1182096943 22:27632373-27632395 CTCCCTAAGCATGGAGGCTGAGG - Intergenic
1182165712 22:28170916-28170938 CTCTCTGCACAGAGAGGCTGGGG - Intronic
1182271081 22:29153854-29153876 CTAGCTACTCCGGGAGGCTGAGG + Intronic
1182631343 22:31687914-31687936 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1182751052 22:32642554-32642576 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1182756189 22:32681520-32681542 ACCACGACTCAGAGAGGCTGAGG + Intronic
1182812683 22:33130916-33130938 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
1183148120 22:36014235-36014257 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1183158382 22:36093257-36093279 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1183491290 22:38117320-38117342 CCAGCTACTCAGAGAGGCTGAGG - Intronic
1183562857 22:38590162-38590184 CCAGCTACTCAGGGAGGCTGAGG + Intronic
1184126575 22:42491641-42491663 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1184182811 22:42842396-42842418 ATCCCAACACTGAGAGGCTGAGG - Intronic
1184209318 22:43025987-43026009 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1184225418 22:43126887-43126909 CTCCCTACTTGGAGGGGATGCGG - Intronic
1184440067 22:44505595-44505617 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
1184982266 22:48102986-48103008 ATCCTGACTCAGAGAGGGTGAGG + Intergenic
1185295254 22:50049881-50049903 CTCCCTTCTCAGAGTCCCTGTGG - Intronic
1185327091 22:50231742-50231764 CCAGCTACTCAGGGAGGCTGAGG + Intronic
1185354001 22:50355351-50355373 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1185379475 22:50501531-50501553 CCAGCTACTCAGAGAGGCTGAGG + Intergenic
1185386945 22:50537572-50537594 CTAGCTACTTAGGGAGGCTGAGG + Intergenic
949747474 3:7311707-7311729 CCAGCTACTCAGGGAGGCTGAGG - Intronic
949925482 3:9037752-9037774 TTGTCTACTCAGAGTGGCTGAGG - Intronic
949977967 3:9477944-9477966 CTGCCCACACAGAGTGGCTGGGG - Exonic
949985925 3:9541053-9541075 CCAGCTACTCAGGGAGGCTGAGG - Intronic
950041916 3:9925229-9925251 CCAGCTACTCAGCGAGGCTGAGG - Intronic
950054914 3:10016855-10016877 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
950512092 3:13436358-13436380 CTCAATACTTTGAGAGGCTGAGG + Intergenic
950710978 3:14812454-14812476 CTCCCTTCTCTGAGAATCTGGGG + Intergenic
950733994 3:14989985-14990007 CTGGCTACTCTGAGAGGCTGAGG + Intronic
950743803 3:15070936-15070958 CCAGCTACTCAGGGAGGCTGAGG - Exonic
951053075 3:18116400-18116422 CCAGCTACTCGGAGAGGCTGAGG + Intronic
952187433 3:30985159-30985181 TTCCCTTTTAAGAGAGGCTGAGG + Intergenic
952274757 3:31866466-31866488 CTCCTTAGTCAGAGTGGATGTGG + Intronic
952340598 3:32442382-32442404 CCAGCTACTCAGAGAGGCTGAGG + Intronic
952401532 3:32967988-32968010 AATCCAACTCAGAGAGGCTGAGG + Intergenic
952783291 3:37126142-37126164 CCAGCTACTCAGGGAGGCTGAGG - Intronic
953027378 3:39152996-39153018 CTCCCCCCTCGGGGAGGCTGCGG - Intronic
953382789 3:42486704-42486726 CTCCCTACTCAAAGTTTCTGAGG - Intergenic
953402352 3:42635790-42635812 CCAGCTACTTAGAGAGGCTGAGG + Intronic
953649135 3:44784285-44784307 CCAGCTACTCGGAGAGGCTGAGG - Intronic
953778234 3:45841851-45841873 TCCCCTTCTCAGGGAGGCTGAGG + Intronic
953993758 3:47503773-47503795 CCAGCTACTCAGAGAGGCTGAGG + Intronic
954097441 3:48339935-48339957 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
954106381 3:48411877-48411899 CCGCCTGCTCAGAGAGGATGTGG - Exonic
954354208 3:50071541-50071563 ATCCCAACACAGAGAGGCTGAGG + Intronic
954542979 3:51407870-51407892 CCAGCTACTCAGGGAGGCTGAGG + Intronic
955557118 3:60150109-60150131 CTAGCTACTCAGGAAGGCTGAGG - Intronic
955700043 3:61673042-61673064 CTAGCTACTCGGAGAGACTGAGG + Intronic
955929791 3:64045103-64045125 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
956110006 3:65860760-65860782 CTGCCTTCTCAGAGAAGCTGGGG - Intronic
956285816 3:67608925-67608947 CTCAGTACTTTGAGAGGCTGAGG - Intronic
957131149 3:76223450-76223472 CTCCCTACTCTCAGTGGTTGTGG - Intronic
957932300 3:86897089-86897111 CCAGCTACTCAGAAAGGCTGAGG - Intergenic
958016640 3:87945646-87945668 CTCCCAACCCAGAAGGGCTGGGG + Intergenic
958511790 3:95059581-95059603 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
958539671 3:95454612-95454634 CTCCCAGCTCTGAGAGGCTGAGG + Intergenic
958772478 3:98442425-98442447 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
959165050 3:102766222-102766244 CTCCCTACTCAAAGAAACTGGGG - Intergenic
959441601 3:106383314-106383336 CTGGCTACTCGGGGAGGCTGAGG - Intergenic
959734197 3:109639189-109639211 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
959941942 3:112089411-112089433 CTAGCTACTCAGGAAGGCTGAGG + Intronic
959973581 3:112433249-112433271 CTAGCTACTCAAGGAGGCTGAGG - Intergenic
960141252 3:114153702-114153724 TCCCTTACTCAGAGATGCTGAGG - Intronic
960413020 3:117351152-117351174 ATGCCTACTCAGGAAGGCTGAGG + Intergenic
961211806 3:125131500-125131522 CCAGCTACTCAGGGAGGCTGAGG - Intronic
961499257 3:127319755-127319777 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
961765458 3:129206847-129206869 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
962006966 3:131359510-131359532 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
962087961 3:132211579-132211601 CCAGCTACTCAGTGAGGCTGAGG - Intronic
962223072 3:133580450-133580472 CTCAGTACTCTGGGAGGCTGAGG + Intronic
962287859 3:134103279-134103301 CCCAACACTCAGAGAGGCTGAGG - Intronic
962734507 3:138313274-138313296 CCAGCTACTCAGGGAGGCTGAGG + Intronic
962961027 3:140311024-140311046 ATGGCTAGTCAGAGAGGCTGAGG + Intronic
963140703 3:141943771-141943793 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
963930000 3:150993950-150993972 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
963943601 3:151120108-151120130 CCAGCTACTCTGAGAGGCTGAGG + Intronic
965289811 3:166865040-166865062 CTGCCAACTCTGAGAGGGTGGGG - Intergenic
965449037 3:168814445-168814467 CTCAACACTCTGAGAGGCTGAGG + Intergenic
966701942 3:182863029-182863051 CCAACTACTCGGAGAGGCTGAGG - Intronic
966729326 3:183137201-183137223 CCAGCTACTCAGGGAGGCTGAGG + Intronic
966781461 3:183587897-183587919 CCAACTACTCAGGGAGGCTGAGG + Intergenic
967160118 3:186728764-186728786 CCAGCTACTCAGGGAGGCTGAGG - Intronic
968019551 3:195372569-195372591 CCCACTACTCTGGGAGGCTGAGG + Intronic
968080956 3:195846833-195846855 CTGCCTCCCCAGTGAGGCTGTGG + Intergenic
968413965 4:412855-412877 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
968502475 4:957332-957354 CTCCCTCCACAGGGAGGCTGTGG - Intronic
968573303 4:1353643-1353665 CCCCCACCTCAGTGAGGCTGTGG + Intronic
968795467 4:2700847-2700869 CTAGCTACTCGGGGAGGCTGAGG + Intronic
969356074 4:6626710-6626732 CTAGCTACTCAGGAAGGCTGAGG + Intergenic
969431217 4:7155729-7155751 CTTCTTGCTCAGAGAGGCCGGGG + Intergenic
969455349 4:7297068-7297090 CTCTCTCCTCAGAGTGCCTGGGG + Intronic
969926683 4:10592071-10592093 CTCCCTCCTCTGAGAACCTGTGG + Intronic
970285669 4:14511539-14511561 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
970524509 4:16917724-16917746 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
970966180 4:21930744-21930766 CTACCTACTTAGAGAAGCTAAGG - Intronic
971073722 4:23124747-23124769 CCCGCTACTCAGGAAGGCTGAGG + Intergenic
972337292 4:38118528-38118550 CTCACAACCCAGAGTGGCTGAGG - Intronic
972458773 4:39279815-39279837 CTAGCTACTCAGGGAGCCTGAGG - Intronic
972510947 4:39768630-39768652 CTCTGTACTTTGAGAGGCTGAGG - Intronic
972627940 4:40819298-40819320 CCAGCTACTCAGGGAGGCTGAGG - Intronic
972761210 4:42106332-42106354 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
972886682 4:43500059-43500081 TTCCCTAGTGAGACAGGCTGAGG + Intergenic
973193780 4:47416564-47416586 CCAGCTACTCAGGGAGGCTGAGG - Intronic
973282717 4:48376735-48376757 CCAGCTACTCGGAGAGGCTGAGG - Intronic
973324906 4:48850372-48850394 CTAGCTACTCAGAGAGCTTGAGG - Intronic
973909733 4:55567280-55567302 CTCAATACTCTGGGAGGCTGAGG + Intronic
974037726 4:56831582-56831604 CCCCATACTTTGAGAGGCTGAGG + Intergenic
974712950 4:65625983-65626005 CCAGCTACTCGGAGAGGCTGAGG + Intronic
975130480 4:70827661-70827683 CCAGCTACTCAAAGAGGCTGAGG + Intronic
975343664 4:73269442-73269464 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
975347141 4:73304863-73304885 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
975560919 4:75707492-75707514 CCAGCTACTCGGAGAGGCTGAGG + Intronic
975725222 4:77285124-77285146 GTCTCTACTCAGGGAGGCTTAGG + Intronic
976065182 4:81178874-81178896 CTCAGTACTCTGGGAGGCTGAGG + Intronic
976216616 4:82721043-82721065 CCAGCTACTCAGAGAGGCTGAGG + Intronic
976674198 4:87686326-87686348 CTAACTACTCAGGGAAGCTGAGG - Intergenic
977069791 4:92370533-92370555 CCAGCTACTCAGGGAGGCTGAGG + Intronic
978027863 4:103900037-103900059 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
978311838 4:107393026-107393048 CTCCCTAGTCTGTGAGGATGTGG + Intergenic
978713609 4:111815176-111815198 CTGCCTTCTCAGAGGAGCTGCGG - Intergenic
978906900 4:114016010-114016032 CCAGCTACTCCGAGAGGCTGAGG + Intergenic
979055803 4:115992300-115992322 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
979150117 4:117301418-117301440 CCAGCTACTCCGAGAGGCTGAGG - Intergenic
979864919 4:125742350-125742372 CTCACCACTCTGGGAGGCTGAGG + Intergenic
980043950 4:127968092-127968114 CCAGCTACTCGGAGAGGCTGAGG + Intronic
980301782 4:131005568-131005590 CTCAGTACTCTGGGAGGCTGAGG + Intergenic
980732166 4:136837510-136837532 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
981897798 4:149824744-149824766 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
981986232 4:150860710-150860732 CCAGCTACTCAGGGAGGCTGAGG + Intronic
982224059 4:153149628-153149650 CCAGCTACTCAGAGAGGCTGAGG + Intergenic
982277940 4:153656030-153656052 CTCCAGACTCAGAGAGGAAGGGG - Intergenic
982406986 4:155031854-155031876 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
982483422 4:155938533-155938555 AGCCCTACTGTGAGAGGCTGGGG + Intronic
982764970 4:159335718-159335740 CCAGCTACTCGGAGAGGCTGAGG + Intronic
982806254 4:159768087-159768109 CTTCCTACCCTGAGAGGCTTTGG + Intergenic
982914787 4:161193796-161193818 CTAGCTACTCCAAGAGGCTGAGG - Intergenic
983229354 4:165113435-165113457 CTCAGTACTTTGAGAGGCTGAGG - Intronic
983332452 4:166347976-166347998 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
983622690 4:169776553-169776575 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
983946120 4:173587176-173587198 CTAGCTACTCAGGAAGGCTGAGG - Intergenic
984314066 4:178103508-178103530 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
984616839 4:181907696-181907718 CTCCCTCCTCTGAGAGCTTGTGG - Intergenic
984733367 4:183088812-183088834 CTCACTACTTTGGGAGGCTGAGG - Intergenic
984799422 4:183699938-183699960 CCAGCTACTCGGAGAGGCTGAGG - Intronic
987641472 5:20617101-20617123 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
987804225 5:22742064-22742086 CCAGCTACTCAGGGAGGCTGAGG + Intronic
988108824 5:26787671-26787693 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
988431632 5:31125786-31125808 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
988998754 5:36739826-36739848 CTCCCTCCTCTGGGAGCCTGCGG - Intergenic
989171849 5:38479110-38479132 CTCCCTACACACACAGGTTGGGG + Exonic
989241886 5:39211434-39211456 CCAGCTACTCGGAGAGGCTGAGG - Intronic
989302871 5:39915079-39915101 CCAACTACTCAGGGAGGCTGAGG + Intergenic
989546480 5:42680617-42680639 CCAGCTACTCAGAGAGGCTGAGG - Intronic
990367089 5:55082107-55082129 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
990389489 5:55304425-55304447 CCAGCTACTCGGAGAGGCTGAGG - Intronic
990517904 5:56547602-56547624 TTCTCTACTCCGAGAGCCTGGGG - Intronic
990529703 5:56660915-56660937 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
990705448 5:58523848-58523870 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
990717594 5:58655909-58655931 CCAGCTACTCGGAGAGGCTGAGG - Intronic
991017428 5:61946903-61946925 CTTACTACTAAGGGAGGCTGGGG - Intergenic
991479390 5:67060725-67060747 CTCCCTACTTTGGGAGGCCGAGG - Intronic
991774486 5:70071628-70071650 CCAGCTACTCGGAGAGGCTGAGG - Intronic
991853780 5:70947053-70947075 CCAGCTACTCGGAGAGGCTGAGG - Intronic
992534498 5:77685185-77685207 CTAGCTACTCGGGGAGGCTGAGG + Intergenic
992878458 5:81081297-81081319 CTCCCTGGTCACAGAGGCTGTGG + Intronic
992885652 5:81157237-81157259 CCAGCTACTCGGAGAGGCTGAGG + Intronic
993364461 5:87019269-87019291 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
993443188 5:87980492-87980514 CTCCCCACGCAGAGAAACTGGGG - Intergenic
994025151 5:95073441-95073463 CTCCATACTCAGTAAGGTTGAGG - Intronic
994059639 5:95460038-95460060 CCAGCTACTCGGAGAGGCTGCGG + Intergenic
994806799 5:104458669-104458691 CCAGCTACTCCGAGAGGCTGAGG - Intergenic
995176892 5:109188297-109188319 CTCCCTCCTTTGGGAGGCTGAGG + Exonic
995254707 5:110033218-110033240 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
995743239 5:115376791-115376813 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
995866911 5:116701267-116701289 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
996761600 5:126991603-126991625 CCAGCTACTCAGGGAGGCTGAGG + Intronic
996762822 5:127003350-127003372 CCAGCTACTCGGAGAGGCTGAGG + Intronic
997109241 5:131056483-131056505 CCAGCTACTCAGAAAGGCTGAGG + Intergenic
997137645 5:131343595-131343617 CTAGCTACTCAGGAAGGCTGAGG + Intronic
997143956 5:131412047-131412069 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
997472032 5:134122536-134122558 CTCCCTCCTTGGAGGGGCTGGGG - Intronic
997484148 5:134215211-134215233 CTAGCTACTCTGTGAGGCTGAGG - Intronic
998082083 5:139284352-139284374 ATCCCAACACTGAGAGGCTGAGG + Intronic
998529178 5:142869320-142869342 CCAGCTACTCAGGGAGGCTGAGG - Intronic
999158125 5:149472986-149473008 CTAGCTACTTAGGGAGGCTGAGG + Intergenic
999288431 5:150407867-150407889 CCAGCTACTCGGAGAGGCTGAGG - Intronic
999319569 5:150605185-150605207 CTCACTACTCACAAAGGCCGTGG - Intronic
999757679 5:154677209-154677231 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
999772100 5:154783341-154783363 TTCCCTACCCAGAGAGGCAAGGG - Intronic
999938737 5:156516880-156516902 CCAGCTACTCAGGGAGGCTGAGG + Intronic
1000062352 5:157668757-157668779 CTCTCCACTCTGAGAGGTTGGGG + Intronic
1001194619 5:169660861-169660883 CTCCCTTCTGAGTGAGGATGAGG + Intronic
1001307656 5:170587304-170587326 CTAGCTACTCCAAGAGGCTGAGG + Intronic
1001593889 5:172885600-172885622 TTTCATACTCAGAGAAGCTGAGG + Intronic
1001628463 5:173156761-173156783 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1001832506 5:174801239-174801261 CTCCCTAGTGAGAGAGGCAAAGG - Intergenic
1001863132 5:175077742-175077764 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1001911982 5:175528033-175528055 CCAGCTTCTCAGAGAGGCTGAGG - Exonic
1002038045 5:176488535-176488557 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1002376819 5:178794880-178794902 CTTCCCACTCACAGAGGCAGAGG + Intergenic
1002624265 5:180513816-180513838 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1003688468 6:8327759-8327781 CTTGCTACTCAGAGAGACAGTGG - Intergenic
1004920718 6:20372942-20372964 CTCAACACTCTGAGAGGCTGAGG + Intergenic
1005353709 6:24961738-24961760 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1005885279 6:30092671-30092693 CCAGCTACTCAGTGAGGCTGAGG + Intergenic
1005888180 6:30113222-30113244 CTCCCTACTCAGAGCTGATTGGG - Intergenic
1006155932 6:32012762-32012784 CTCCCTTCTGAGAGAAGCTGAGG + Intergenic
1006162265 6:32045616-32045638 CTCCCTTCTGAGAGAAGCTGAGG + Exonic
1006506364 6:34491325-34491347 CTCCCGAATTGGAGAGGCTGGGG - Intronic
1006776634 6:36597943-36597965 CCCAGCACTCAGAGAGGCTGAGG - Intronic
1006827134 6:36943834-36943856 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
1007458615 6:42000353-42000375 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1007565477 6:42847011-42847033 CTCCGCACTTAGAGGGGCTGAGG + Intronic
1007571484 6:42894303-42894325 CTCCCCACTGAGACAGCCTGAGG - Intergenic
1007572506 6:42903263-42903285 CTCCCCACTGAGACAGCCTGAGG - Intergenic
1007901011 6:45412858-45412880 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1008231378 6:48988233-48988255 CTAGCTACTCAGGGAGGCTGAGG - Intergenic
1008680077 6:53862751-53862773 CTGCCTCCTCAGTGAGTCTGTGG + Intronic
1009753100 6:67898553-67898575 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1009832348 6:68954793-68954815 CTAGCTACTCCGGGAGGCTGAGG - Intronic
1010233447 6:73555373-73555395 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
1011674048 6:89713921-89713943 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1011687054 6:89831890-89831912 CTCAGTACTCTGGGAGGCTGAGG - Intronic
1011689599 6:89854351-89854373 CCAGCTACTCAGGGAGGCTGAGG + Intronic
1012668597 6:102011697-102011719 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1012687625 6:102272463-102272485 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1012756096 6:103232459-103232481 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
1013104543 6:107015580-107015602 CTGGCTACTCAGGGAGGCTAAGG - Intergenic
1013129065 6:107214217-107214239 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1013284473 6:108668995-108669017 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1013351457 6:109309746-109309768 GGACCTACTGAGAGAGGCTGTGG - Intergenic
1013657671 6:112262214-112262236 CCAGCTACTCAGCGAGGCTGAGG + Intergenic
1013836657 6:114342622-114342644 CTCCCCCCGCAGAGCGGCTGCGG - Exonic
1013847796 6:114475682-114475704 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1014222661 6:118814007-118814029 CTAGCTACTCGGGGAGGCTGAGG - Exonic
1014378332 6:120705892-120705914 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1015001618 6:128223415-128223437 ACCACAACTCAGAGAGGCTGAGG + Intronic
1015122715 6:129717681-129717703 CTAGCTACTCAGGGAGACTGAGG - Intergenic
1015135006 6:129858907-129858929 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1015259217 6:131215472-131215494 CTCCTGACTCAGAGGAGCTGAGG + Intronic
1015394833 6:132721766-132721788 TTCCCTACACAGGGAGGCGGAGG + Intergenic
1015519534 6:134116267-134116289 CTCAGTACTTTGAGAGGCTGGGG - Intergenic
1015545228 6:134355050-134355072 CTAGCTACTCTGGGAGGCTGAGG - Intergenic
1015751155 6:136560695-136560717 CCCAGTACTCTGAGAGGCTGAGG + Intronic
1016060006 6:139620276-139620298 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
1016425338 6:143930500-143930522 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1016885271 6:148953654-148953676 CCAGCTACTCAGAGAGGCTGAGG + Intronic
1016928366 6:149377183-149377205 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1016954349 6:149611882-149611904 CCAGCTACTCAGGGAGGCTGAGG + Intronic
1017117376 6:150990969-150990991 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1017254967 6:152323321-152323343 CCAGCTACTCAGAGAGGCTGAGG + Intronic
1017423525 6:154297152-154297174 CCAGCTACTCAGTGAGGCTGAGG - Intronic
1018072109 6:160173981-160174003 CTCCCTGCTCAGGGAGGGTGAGG + Intronic
1018411246 6:163550829-163550851 CCAGCTACTCAGAGAGGCTGAGG + Intronic
1018424589 6:163668971-163668993 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1018798744 6:167206907-167206929 CTCCCTGATCAGCCAGGCTGGGG + Intergenic
1019099032 6:169612302-169612324 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1019114553 6:169749213-169749235 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1019135762 6:169906734-169906756 CACCCTCCACAGAGAGGCTTTGG + Intergenic
1019561043 7:1657576-1657598 CCAGCTACTCAGAGATGCTGAGG + Intergenic
1019594589 7:1852488-1852510 CTCCCTGGGCGGAGAGGCTGGGG + Intronic
1019683240 7:2365065-2365087 CCCGCTACTCAGGAAGGCTGAGG - Intronic
1019791582 7:3017466-3017488 CTCCATCCTGAGTGAGGCTGAGG + Intronic
1020035607 7:4961238-4961260 CTCCCCACTTTGGGAGGCTGAGG - Intergenic
1020059043 7:5138752-5138774 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
1020075976 7:5259204-5259226 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
1020078030 7:5271373-5271395 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
1020161254 7:5773681-5773703 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1020341955 7:7121375-7121397 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1020509424 7:9034764-9034786 CTCCATCCTCACAGAAGCTGGGG - Intergenic
1020516417 7:9126279-9126301 CTCAGTACTTAGGGAGGCTGAGG - Intergenic
1020796018 7:12679625-12679647 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1021226692 7:18036417-18036439 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1021527069 7:21599996-21600018 TTCCCTAGACAGAGAGGCTGGGG + Exonic
1022019937 7:26388893-26388915 CTCCCTTCCCTGGGAGGCTGAGG + Intergenic
1022694655 7:32692480-32692502 CTCACTACACAGAGATGGTGTGG - Intergenic
1022864553 7:34404376-34404398 CTGCTGACTGAGAGAGGCTGGGG + Intergenic
1022925235 7:35050084-35050106 CTCAGTACTCTGGGAGGCTGAGG - Intergenic
1022927836 7:35073980-35074002 CTCACTACACAGAGATGGTGTGG - Intergenic
1023104994 7:36755484-36755506 CCATCTACTCAGGGAGGCTGAGG - Intergenic
1023266180 7:38408634-38408656 CCAGCTACTCAGAGAGGCTGAGG + Intronic
1023349612 7:39307837-39307859 CCAGCTACTCAGAGAGGCTGAGG + Intronic
1023443171 7:40205137-40205159 CTAGCTACTCGGGGAGGCTGAGG + Intronic
1023452223 7:40299275-40299297 CTCTCTCCTCAGACAGGATGTGG - Intronic
1024260239 7:47568854-47568876 GTCCTTCCTCAAAGAGGCTGCGG - Intronic
1025086020 7:56024040-56024062 CCAGCTACTTAGAGAGGCTGAGG - Intronic
1025145675 7:56500657-56500679 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1025200865 7:56960800-56960822 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1025618380 7:63144324-63144346 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
1025671078 7:63616132-63616154 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
1025723134 7:64034423-64034445 CTAGCTACTCTGGGAGGCTGAGG + Intronic
1025792050 7:64697804-64697826 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1025949517 7:66132793-66132815 CCAGCTACTCAGAGAGGCTGAGG + Intronic
1025977644 7:66381553-66381575 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1026273766 7:68859267-68859289 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
1026441314 7:70446785-70446807 CTTCCTGCTCAGAGGTGCTGCGG + Intronic
1026712188 7:72752041-72752063 CTCTCTACCCAGAGATACTGGGG - Intronic
1026953916 7:74364906-74364928 CCAGCTACTCAGGGAGGCTGAGG + Intronic
1026967163 7:74447583-74447605 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
1027123797 7:75541413-75541435 CCAGCTACTCAGAGAGGCTGAGG + Intronic
1027370576 7:77505587-77505609 CTAGCTACTCAAGGAGGCTGAGG - Intergenic
1027907036 7:84198046-84198068 CTCCTTACTCTGAGAATCTGTGG + Intronic
1028201617 7:87968604-87968626 CCAGCTACTCAGAGGGGCTGAGG + Intronic
1029010468 7:97256354-97256376 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
1029011547 7:97267385-97267407 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1029102923 7:98148863-98148885 ATGCGTACTCAGAAAGGCTGAGG - Intronic
1029300927 7:99581906-99581928 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1029823252 7:103164775-103164797 CTCAGTACTCTGGGAGGCTGAGG - Intergenic
1030035820 7:105407549-105407571 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
1030035848 7:105407851-105407873 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1030263740 7:107594436-107594458 CTCCGTACTTTGGGAGGCTGAGG - Intronic
1030284614 7:107813334-107813356 CTAGCTACTCGGAGATGCTGAGG - Intergenic
1030552461 7:110980341-110980363 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1031005348 7:116464226-116464248 CCTGCTACTCAGGGAGGCTGAGG - Intronic
1031008939 7:116503712-116503734 CCAGCTACTCAGGGAGGCTGAGG + Intronic
1031665327 7:124476379-124476401 CTCCCCACTCAGGGTGGCTGTGG + Intergenic
1031743032 7:125457921-125457943 CTGACTTCTCAGAGTGGCTGGGG - Intergenic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1032040142 7:128552873-128552895 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1032239726 7:130151220-130151242 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1032739245 7:134722534-134722556 CTAGCTACTCGGGGAGGCTGAGG - Intergenic
1032752651 7:134857282-134857304 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1032981091 7:137284080-137284102 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1033083901 7:138324516-138324538 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
1033295242 7:140127073-140127095 CCAGCTACTCAGAGAGGCTGAGG - Intronic
1033571432 7:142632634-142632656 CTCCCGACTCAGGCAGGCCGAGG + Intergenic
1034073240 7:148207971-148207993 CCAGCTACTCAGAGAGGCTGAGG + Intronic
1034092797 7:148379595-148379617 CCAGCTACTCAAAGAGGCTGAGG + Intronic
1034205921 7:149315196-149315218 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1034622622 7:152468018-152468040 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1034649310 7:152676720-152676742 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
1034869915 7:154674897-154674919 CTCCAGACCAAGAGAGGCTGAGG + Intronic
1035233313 7:157479750-157479772 CCAACTACTCAGGGAGGCTGAGG - Intergenic
1035739763 8:1917888-1917910 CCAGCTACTCAGAGAGGCTGAGG - Intronic
1036027327 8:4924470-4924492 CTCAGTACTTTGAGAGGCTGGGG + Intronic
1036787867 8:11699727-11699749 CTCCCTATTCAAAAAGGCTATGG + Intronic
1036821719 8:11945334-11945356 CTAGCTACTGGGAGAGGCTGAGG + Intergenic
1036823679 8:11959382-11959404 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
1036911173 8:12758510-12758532 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1037170025 8:15879787-15879809 CCTGCTACTCAGGGAGGCTGAGG - Intergenic
1037178159 8:15971693-15971715 CCACCTACTCTGAGAGACTGAGG - Intergenic
1038016199 8:23517447-23517469 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1038070565 8:24008276-24008298 CTAGCTACTCGGGGAGGCTGAGG + Intergenic
1038707732 8:29910465-29910487 CACCCTACTATGAGTGGCTGTGG + Intergenic
1038728081 8:30099484-30099506 CCAGCTACTCAGAAAGGCTGAGG + Intronic
1038811631 8:30852218-30852240 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1039085329 8:33774177-33774199 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
1039174182 8:34784527-34784549 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1039294943 8:36140417-36140439 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1039367369 8:36944447-36944469 CTCCCCACTCAAACAGGCTGTGG - Intergenic
1039601903 8:38846166-38846188 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1039624716 8:39037170-39037192 CCAGCTACTCAGAGAGGCTGAGG - Intronic
1039865834 8:41500678-41500700 CCCAATACTCTGAGAGGCTGAGG - Intronic
1039918854 8:41878946-41878968 CCAGCTACTCAGGGAGGCTGAGG + Intronic
1040512620 8:48108447-48108469 CTCCCAAGTCAGGGAGGCTGTGG - Intergenic
1040808755 8:51425704-51425726 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1040989140 8:53330455-53330477 CTAGCTACACAGGGAGGCTGAGG - Intergenic
1041082066 8:54223532-54223554 CTCAGTACTTTGAGAGGCTGAGG + Intergenic
1041383297 8:57274714-57274736 GTCTCTCCTCTGAGAGGCTGGGG - Intergenic
1041486316 8:58381219-58381241 CCCAGTACTCTGAGAGGCTGAGG - Intergenic
1041501815 8:58547216-58547238 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1042070081 8:64923499-64923521 CCAGCTGCTCAGAGAGGCTGAGG - Intergenic
1042531623 8:69821687-69821709 CCACCTACTCAGGGAGGCTAAGG + Intronic
1042910431 8:73820624-73820646 GCAGCTACTCAGAGAGGCTGAGG + Intronic
1043242825 8:77957438-77957460 CCAGCTACTCAGAGAGGCTGAGG + Intergenic
1043544809 8:81303046-81303068 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
1043548194 8:81338696-81338718 CTCCCTAATCAGTGTAGCTGTGG - Intergenic
1043855524 8:85260947-85260969 CTACATACTCAGAGAGGCTTAGG + Intronic
1044702348 8:94976081-94976103 CCAGCTACTCAGAGAGGCTGAGG + Intronic
1044998892 8:97863053-97863075 CCAGTTACTCAGAGAGGCTGAGG - Intergenic
1045000476 8:97873876-97873898 CTCAGTACTTTGAGAGGCTGAGG - Intronic
1045167322 8:99621233-99621255 CTCCATATACAGAGAGACTGGGG - Intronic
1045493012 8:102684758-102684780 CCAGCTACTCAGAAAGGCTGAGG - Intergenic
1046233800 8:111394075-111394097 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
1046498054 8:115039959-115039981 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1047106302 8:121734147-121734169 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
1047764353 8:127978265-127978287 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1048283310 8:133121317-133121339 CCCCCTCCTCAAAGAGGCTCAGG - Intronic
1048779978 8:137989961-137989983 CTCCCAACTCCGAAGGGCTGGGG - Intergenic
1048833763 8:138499254-138499276 CTACCTACTTGGAGGGGCTGAGG - Intergenic
1049129007 8:140820213-140820235 CCAGCTACTCAGGGAGGCTGGGG - Intronic
1049167297 8:141134408-141134430 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1049393541 8:142384276-142384298 CTTCCTTCTCAGAGAGGCAGGGG - Intronic
1049644705 8:143730841-143730863 CTCCTTTCTCTGGGAGGCTGAGG + Intronic
1049722885 8:144128511-144128533 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1049732081 8:144183760-144183782 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1050473669 9:6019023-6019045 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
1050523933 9:6529371-6529393 CTCAGTACTTTGAGAGGCTGAGG - Intergenic
1050544499 9:6698315-6698337 CTCAGTGCTCTGAGAGGCTGAGG - Intergenic
1050887743 9:10786831-10786853 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1051057157 9:13001177-13001199 ATCCCAACACTGAGAGGCTGAGG + Intergenic
1051233532 9:14976601-14976623 CCACCTACTCAGAGAGGCTGAGG - Intergenic
1051340266 9:16104010-16104032 CTCCCTTGGCAGAGAGGCTGTGG + Intergenic
1051637124 9:19190800-19190822 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
1051728410 9:20112696-20112718 CTCCCTGCTCAGATTTGCTGGGG + Intergenic
1052216023 9:25966480-25966502 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1052497780 9:29249351-29249373 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
1052515834 9:29478312-29478334 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1053022008 9:34701534-34701556 CGAGCTCCTCAGAGAGGCTGCGG + Intergenic
1053205523 9:36183021-36183043 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
1053466587 9:38312868-38312890 CTCAGCACTCTGAGAGGCTGAGG + Intergenic
1053506928 9:38651096-38651118 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
1053592974 9:39533134-39533156 CTCCCTGCTCTGAGATGTTGGGG - Intergenic
1054573332 9:66832143-66832165 CTCCCTGCTCTGAGATGTTGGGG + Intergenic
1055315807 9:75032832-75032854 CCAGCTACTCACAGAGGCTGAGG - Intergenic
1055482290 9:76720984-76721006 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1055842167 9:80518781-80518803 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1055868600 9:80845974-80845996 CCCAGTACTTAGAGAGGCTGAGG - Intergenic
1056108287 9:83369459-83369481 CCAGCTACTCAGGGAGGCTGAGG + Intronic
1056138114 9:83648903-83648925 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1056180192 9:84075561-84075583 TTCTCTCCTCAGAGAAGCTGTGG - Intergenic
1056844622 9:90026468-90026490 GTCCCTACTGTGACAGGCTGGGG + Intergenic
1056962076 9:91134260-91134282 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1056979791 9:91299101-91299123 CAAGCTACTCAAAGAGGCTGAGG + Intronic
1057497489 9:95572322-95572344 CTCACCACTTAGGGAGGCTGAGG - Intergenic
1058091270 9:100808449-100808471 CTAGCTACTCAGGGAGGCTGAGG + Intergenic
1058718420 9:107742126-107742148 CTCCCTTTCCAGAGAGGCAGGGG + Intergenic
1058887468 9:109332272-109332294 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1059173983 9:112152515-112152537 CTAGCTACTCAGGGAGGTTGGGG - Intronic
1060080350 9:120638106-120638128 CTAGCAACTCAGAGGGGCTGAGG - Intronic
1060084659 9:120686203-120686225 CCAGCTGCTCAGAGAGGCTGAGG - Intronic
1060299040 9:122363278-122363300 ATCCCAGCTCAGGGAGGCTGAGG - Intergenic
1060422450 9:123479041-123479063 CTCTCCTCTCAGAGAGGGTGGGG + Intronic
1060448176 9:123711348-123711370 ACAGCTACTCAGAGAGGCTGAGG + Intronic
1060840977 9:126792979-126793001 CTCCCCACACAGAGGGGCGGAGG - Intergenic
1060974532 9:127756758-127756780 CCAGCTACTCGGAGAGGCTGAGG - Intronic
1061041338 9:128142495-128142517 CCACCTACTCAGGAAGGCTGAGG + Intergenic
1061468422 9:130802206-130802228 CCAGCTACTCAAAGAGGCTGAGG - Intronic
1062108786 9:134770610-134770632 CTCACCACTCGGAGTGGCTGTGG - Intronic
1062258327 9:135642254-135642276 CTAGCTACTCAAGGAGGCTGAGG + Intergenic
1062737219 9:138144120-138144142 CCCTCTTCTCAGAGAGGCCGGGG - Intergenic
1185509910 X:656192-656214 CTCAGTACTCTGGGAGGCTGGGG + Intronic
1185608310 X:1379873-1379895 CCAGCTACTCAGGGAGGCTGAGG - Intronic
1185647557 X:1625837-1625859 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1185693306 X:2174524-2174546 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1185731176 X:2463198-2463220 CTCCCTACTCAGAGAGGCTGTGG + Intronic
1186310238 X:8309825-8309847 CAAGCTACTCAGGGAGGCTGAGG + Intergenic
1187136041 X:16548474-16548496 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1187249522 X:17584257-17584279 CTCCCTCCTCAGAGCCTCTGAGG - Intronic
1187295791 X:17999290-17999312 CTCCTTAGTCAGATGGGCTGAGG + Intergenic
1188513976 X:30965352-30965374 CCAGCTACTCAGGGAGGCTGGGG + Intronic
1189060659 X:37749542-37749564 CACAATACTCAGGGAGGCTGAGG - Intronic
1189250735 X:39599180-39599202 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1189377353 X:40475999-40476021 CTCCCTGCTCAGAGAGGCCAGGG - Intergenic
1189442450 X:41049404-41049426 CCAGCTACTCAGAGAGGCTGAGG + Intergenic
1190211675 X:48453690-48453712 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1190471812 X:50788490-50788512 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1190715765 X:53101882-53101904 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
1192108553 X:68340888-68340910 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1192144830 X:68675070-68675092 CTAGCTACTCGGGGAGGCTGAGG - Intronic
1192209952 X:69121693-69121715 CTCCCTCCTCCTTGAGGCTGAGG + Intergenic
1192257436 X:69474257-69474279 CTAGCTACTCAGGGAGGCTTAGG - Intergenic
1192461866 X:71323883-71323905 ATCCCAACACTGAGAGGCTGAGG - Intergenic
1192639280 X:72847161-72847183 CTGCCCACTCAGAGTGGCAGCGG + Exonic
1192642431 X:72873644-72873666 CTGCCCACTCAGAGTGGCAGCGG - Exonic
1193097636 X:77568996-77569018 ATTCCTACTCAAAGAGGCTGAGG + Intronic
1193166369 X:78285304-78285326 CCAGCTACTCGGAGAGGCTGAGG + Intronic
1193472852 X:81927788-81927810 CCAGCTACTCAGGGAGGCTGAGG + Intergenic
1194439850 X:93918741-93918763 CCAGCTACTCAGAGAGGCTGAGG + Intergenic
1195293246 X:103449675-103449697 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1196044184 X:111239490-111239512 CTCCCTATTCAGTGGTGCTGGGG + Intergenic
1196373264 X:115001989-115002011 CTCCCTACACAGAATGGCAGTGG - Intergenic
1196436531 X:115680030-115680052 CCAGCTACTCGGAGAGGCTGAGG - Intergenic
1196439502 X:115705388-115705410 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
1196971287 X:121111443-121111465 CCAGCTACTCAGGGAGGCTGAGG - Intergenic
1197014450 X:121606896-121606918 CCAACTACTCAGGGAGGCTGAGG - Intergenic
1197104504 X:122698325-122698347 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
1197215961 X:123867183-123867205 CCAGCTACTTAGAGAGGCTGAGG - Intronic
1197611265 X:128641325-128641347 CACCTTTCTCAGAGAGGCAGAGG + Intergenic
1199826252 X:151503567-151503589 CTAGCTACTCAGGGTGGCTGAGG - Intergenic
1200830810 Y:7687627-7687649 CTCCCTATTTAGGGAGCCTGGGG - Intergenic
1201191864 Y:11451086-11451108 CCAGCCACTCAGAGAGGCTGAGG + Intergenic
1201468110 Y:14307265-14307287 CTCAATACTCTGGGAGGCTGAGG - Intergenic
1201677289 Y:16600970-16600992 CCAGCTACTCGGAGAGGCTGAGG + Intergenic
1201899365 Y:19032599-19032621 CCAGCTACTCAGGGAGGCTGAGG - Intergenic