ID: 1185735396

View in Genome Browser
Species Human (GRCh38)
Location X:2491947-2491969
Sequence GGTTGCCCAAAATGACAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 94}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185735386_1185735396 16 Left 1185735386 X:2491908-2491930 CCCTTCCAGCTGCCACTCAGGAG 0: 1
1: 0
2: 4
3: 28
4: 297
Right 1185735396 X:2491947-2491969 GGTTGCCCAAAATGACAGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 94
1185735393_1185735396 -8 Left 1185735393 X:2491932-2491954 CCACCTCTGTGACTGGGTTGCCC 0: 1
1: 0
2: 1
3: 21
4: 209
Right 1185735396 X:2491947-2491969 GGTTGCCCAAAATGACAGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 94
1185735389_1185735396 11 Left 1185735389 X:2491913-2491935 CCAGCTGCCACTCAGGAGGCCAC 0: 1
1: 0
2: 2
3: 26
4: 318
Right 1185735396 X:2491947-2491969 GGTTGCCCAAAATGACAGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 94
1185735390_1185735396 4 Left 1185735390 X:2491920-2491942 CCACTCAGGAGGCCACCTCTGTG 0: 1
1: 0
2: 0
3: 28
4: 260
Right 1185735396 X:2491947-2491969 GGTTGCCCAAAATGACAGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 94
1185735387_1185735396 15 Left 1185735387 X:2491909-2491931 CCTTCCAGCTGCCACTCAGGAGG 0: 1
1: 0
2: 4
3: 29
4: 282
Right 1185735396 X:2491947-2491969 GGTTGCCCAAAATGACAGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185735396 Original CRISPR GGTTGCCCAAAATGACAGCT GGG Intronic
902491870 1:16788506-16788528 AGTTGCCCAAAAAGACACGTTGG - Intronic
909399326 1:75209020-75209042 TGTTGCCCATAGTAACAGCTAGG + Intronic
911769050 1:101715873-101715895 TCTTGCCCAAAATCACAGTTAGG + Intergenic
912132790 1:106622314-106622336 GGGTGCCCATAATCCCAGCTGGG + Intergenic
915035785 1:152922986-152923008 GTTTGCCCAAAATGACAATCTGG - Intergenic
918005477 1:180538277-180538299 GGGATCCCAAAATGACACCTAGG + Intergenic
923528576 1:234794033-234794055 AGTTGCCCAAAAAGACACGTTGG + Intergenic
1064255336 10:13738504-13738526 GCTCACCCAAGATGACAGCTGGG + Intronic
1066216330 10:33291859-33291881 GGTTGGCCAAGATCACAGTTAGG + Intronic
1068453054 10:57218016-57218038 GGTATCCCAAAATGACAACTTGG + Intergenic
1069821859 10:71233412-71233434 TGTTGCCCAGAATAACAGCCCGG + Intronic
1073838265 10:107469362-107469384 GGTTGTCCAAAATGTGAGCAGGG + Intergenic
1079331451 11:19536263-19536285 GCTTGACCAAAATGTCAGCTGGG - Intronic
1079658424 11:23010912-23010934 ACTTGCCCAAATTCACAGCTAGG + Intergenic
1080834076 11:35923633-35923655 GATTGTCCAGAATGTCAGCTTGG - Intergenic
1082068041 11:47916674-47916696 GGCTGCCCAACAGGAAAGCTGGG - Intergenic
1087530337 11:99373340-99373362 GGTGGCCCAAAGGGACATCTTGG + Intronic
1088561269 11:111118635-111118657 GGTTGCCATAAATAACAGTTTGG + Intergenic
1091311732 11:134579783-134579805 GGGAGCCCAAAATGACAAATAGG - Intergenic
1095096107 12:38150155-38150177 GGTGGCCCAAAATGCCAACTCGG - Intergenic
1099133946 12:78870040-78870062 GTTTGTACAAAATGAGAGCTGGG + Intronic
1100697323 12:97109688-97109710 TTTTGCCCCAAAGGACAGCTGGG - Intergenic
1106176358 13:27335783-27335805 AGTTGCCTAAAATGAGGGCTTGG - Intergenic
1111715524 13:91874858-91874880 ATTAGCACAAAATGACAGCTAGG - Intronic
1114650130 14:24279482-24279504 GGTTGCCCTAAAAGACAGAAGGG + Intergenic
1116238101 14:42307490-42307512 GGTTTACCGAAATGACAGCAAGG - Intergenic
1117189802 14:53278545-53278567 GGGGGCCCAAATTCACAGCTTGG - Intergenic
1118731459 14:68669892-68669914 GGTTGTCCAAACTGACAGGCAGG - Intronic
1124049248 15:26179801-26179823 GTTTACCCAATATCACAGCTGGG + Intergenic
1127707215 15:61559185-61559207 GTTTCCCCAAAATGTCTGCTTGG - Intergenic
1130906066 15:88241611-88241633 GGTTGGGCAGAATGCCAGCTGGG + Intronic
1131133291 15:89913402-89913424 GCTTGCCCAAGCTCACAGCTGGG - Intergenic
1134220012 16:12346469-12346491 AGTTGCCCAAAGTCACATCTAGG + Intronic
1138418139 16:56883113-56883135 AATTGCCCAAAGTCACAGCTAGG + Intronic
1148881384 17:50730390-50730412 AGTTGCCCATAATCCCAGCTTGG + Intronic
1148975096 17:51520533-51520555 GGTAGCCCAAGATGGGAGCTGGG - Intergenic
1149530463 17:57390941-57390963 GGTTCCCCAAGATGATAGATCGG + Intronic
1149864899 17:60145908-60145930 GTTTGCCCAAATTCACAGCAAGG - Intergenic
1152358197 17:79816605-79816627 GGTTGACCTGAATGACATCTAGG + Intergenic
1155461702 18:26090813-26090835 GGGTGCCCATAAGGAGAGCTCGG - Intronic
1158018148 18:52809128-52809150 AACTGCCAAAAATGACAGCTAGG + Intronic
1162872954 19:13599802-13599824 GGTGGGCCAAGATGACATCTCGG + Intronic
1163397318 19:17071323-17071345 GGCTGCCCAGATTGACAGCCCGG - Intronic
930989154 2:57629740-57629762 GATTGCCCAACAAGACACCTAGG - Intergenic
933862999 2:86488715-86488737 GGTTGCCCAAAGTGACTGCAGGG + Intronic
935352449 2:102164315-102164337 AGGTGTCCAAAATTACAGCTAGG - Intronic
937222180 2:120347960-120347982 GGTGGCACAAAATGACAGCGGGG + Intronic
948947550 2:241228765-241228787 GTTTGCCTTAGATGACAGCTGGG - Exonic
1169656878 20:7934077-7934099 ACTTGCCCAAAGTCACAGCTAGG - Intronic
1173584397 20:44171304-44171326 CGTTGCCCAAAATCAAAGCAAGG + Intronic
1175818445 20:61895846-61895868 CGGGGCCCAAAATGACAGCCTGG - Intronic
1176869869 21:14075911-14075933 GGTGGCCCAAAATGCCAACTCGG + Intergenic
1177438942 21:21093435-21093457 CGTTGTCCAAATTGACATCTTGG + Intronic
1181373820 22:22440412-22440434 GGCTGCAGATAATGACAGCTGGG + Intergenic
1182390257 22:29988024-29988046 GTTTGCCCCAAATGACAGAGTGG - Intronic
1183515996 22:38266436-38266458 GCTTGCCCAAGGTCACAGCTGGG + Intronic
950944374 3:16929381-16929403 GGTTTCCCAAAAAGACTTCTGGG + Intronic
951511851 3:23511127-23511149 TCTTGCTCAAAATGTCAGCTGGG - Intronic
952773850 3:37025918-37025940 GGCTGCCAAAAATCAGAGCTTGG + Exonic
956804963 3:72800453-72800475 AGTTGGCCAAGATCACAGCTAGG + Intronic
961959542 3:130840206-130840228 AGTAGCTCAAAATGACAGCATGG - Intergenic
963406239 3:144867543-144867565 AGTTGCCCAGAATGGAAGCTTGG + Intergenic
967293293 3:187942684-187942706 GATTGTCCTAAATGACACCTAGG + Intergenic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
968657865 4:1786408-1786430 GGTTGCCCCATTTTACAGCTGGG - Intergenic
969123374 4:4926359-4926381 GGTTTACCAGAATGACAGCAAGG + Intergenic
972139248 4:35936407-35936429 GGTTGCCTAAGATAAAAGCTAGG + Intergenic
979811951 4:125047270-125047292 TGTTGACCAAAATGACATTTGGG - Intergenic
980873352 4:138635389-138635411 TGTGGCCCTAAATGACATCTGGG - Intergenic
981925345 4:150132921-150132943 GGTTGATCAAAATGTTAGCTGGG - Intronic
985275942 4:188237896-188237918 GGTTACCTGGAATGACAGCTGGG - Intergenic
989073589 5:37538235-37538257 AGTTGCCCAAAATGAGAGGCAGG - Intronic
990476151 5:56163409-56163431 GGTAACACAAAATGAGAGCTCGG - Intronic
994768253 5:103950066-103950088 TCTTGCCCAAAATGACATCAAGG + Intergenic
995018804 5:107344092-107344114 GGTTCCCCAAAATGTCACCAAGG + Intergenic
999955736 5:156699671-156699693 GGTTTCCTGAACTGACAGCTAGG - Intronic
1000878391 5:166668494-166668516 GGTCGGCAAAAATGAAAGCTGGG - Intergenic
1002635681 5:180607194-180607216 ATTTGCCCAACATGACAGCCAGG - Intronic
1011260773 6:85467320-85467342 AGATGCCCTAAATCACAGCTTGG + Intronic
1021498740 7:21306040-21306062 AGTGGCACCAAATGACAGCTGGG - Intergenic
1030471108 7:109963375-109963397 TGGGGCCCATAATGACAGCTAGG + Intergenic
1032718907 7:134534788-134534810 GGTTTCCCAAAATTTCAGATGGG - Intronic
1040279047 8:46028765-46028787 GGTGGCCCAAAATGCCACCCCGG + Intergenic
1043584977 8:81758330-81758352 AGTTGCCTAAAATGATAGCCAGG + Intronic
1049589598 8:143451073-143451095 GGGTGCCCACAAGGACAGCAGGG + Intronic
1050872595 9:10592370-10592392 GGCTGTTTAAAATGACAGCTTGG + Intronic
1055123964 9:72697261-72697283 GGTTGCACAAAAGTAGAGCTGGG - Intronic
1055283461 9:74701172-74701194 GTTTGACCAAAATGACCACTGGG + Intergenic
1058429969 9:104909500-104909522 GGGTGGCTTAAATGACAGCTGGG + Intronic
1059320462 9:113464483-113464505 AGTTCCCCCAAATAACAGCTGGG + Intronic
1060109317 9:120895059-120895081 CTTTGCCCAAGATGACAGTTGGG + Intergenic
1060761400 9:126252924-126252946 GGCTCCCCAAAATGCCAGTTAGG - Intergenic
1185735396 X:2491947-2491969 GGTTGCCCAAAATGACAGCTGGG + Intronic
1186762840 X:12741293-12741315 GGTTGCCCAAAAGGAACCCTTGG - Intergenic
1188810312 X:34646113-34646135 GGTTGTCCAAAATGCCAGATGGG + Intronic
1189640569 X:43066315-43066337 TCTAGCCCTAAATGACAGCTGGG - Intergenic
1192170865 X:68853918-68853940 GGGTGGCAAAAATGACAGATTGG - Intergenic
1193868864 X:86772048-86772070 GCTTGCCCAAATTCACAGCAAGG - Intronic
1195581718 X:106511523-106511545 GGTTTCACAAAATGGCACCTGGG - Intergenic
1198750154 X:139931571-139931593 GGTGGCCCAAAAGAAGAGCTGGG - Intronic
1200698284 Y:6380476-6380498 GGCTGACCAATATGACAGCCAGG - Intergenic
1201035830 Y:9784223-9784245 GGCTGACCAATATGACAGCCAGG + Intergenic