ID: 1185737432

View in Genome Browser
Species Human (GRCh38)
Location X:2503952-2503974
Sequence TTGAGGTTCTGTGGGGAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185737432_1185737441 8 Left 1185737432 X:2503952-2503974 CCTCACTCCCCACAGAACCTCAA No data
Right 1185737441 X:2503983-2504005 AAGGGGCACCCCCAGTGTGCAGG No data
1185737432_1185737448 29 Left 1185737432 X:2503952-2503974 CCTCACTCCCCACAGAACCTCAA No data
Right 1185737448 X:2504004-2504026 GGTTGCACCCAGCCACTGGGTGG No data
1185737432_1185737439 -9 Left 1185737432 X:2503952-2503974 CCTCACTCCCCACAGAACCTCAA No data
Right 1185737439 X:2503966-2503988 GAACCTCAACAGGCACTAAGGGG No data
1185737432_1185737446 25 Left 1185737432 X:2503952-2503974 CCTCACTCCCCACAGAACCTCAA No data
Right 1185737446 X:2504000-2504022 TGCAGGTTGCACCCAGCCACTGG No data
1185737432_1185737447 26 Left 1185737432 X:2503952-2503974 CCTCACTCCCCACAGAACCTCAA No data
Right 1185737447 X:2504001-2504023 GCAGGTTGCACCCAGCCACTGGG No data
1185737432_1185737438 -10 Left 1185737432 X:2503952-2503974 CCTCACTCCCCACAGAACCTCAA No data
Right 1185737438 X:2503965-2503987 AGAACCTCAACAGGCACTAAGGG No data
1185737432_1185737449 30 Left 1185737432 X:2503952-2503974 CCTCACTCCCCACAGAACCTCAA No data
Right 1185737449 X:2504005-2504027 GTTGCACCCAGCCACTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185737432 Original CRISPR TTGAGGTTCTGTGGGGAGTG AGG (reversed) Intergenic