ID: 1185737434

View in Genome Browser
Species Human (GRCh38)
Location X:2503959-2503981
Sequence GTGCCTGTTGAGGTTCTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185737434_1185737441 1 Left 1185737434 X:2503959-2503981 CCCCACAGAACCTCAACAGGCAC No data
Right 1185737441 X:2503983-2504005 AAGGGGCACCCCCAGTGTGCAGG No data
1185737434_1185737447 19 Left 1185737434 X:2503959-2503981 CCCCACAGAACCTCAACAGGCAC No data
Right 1185737447 X:2504001-2504023 GCAGGTTGCACCCAGCCACTGGG No data
1185737434_1185737448 22 Left 1185737434 X:2503959-2503981 CCCCACAGAACCTCAACAGGCAC No data
Right 1185737448 X:2504004-2504026 GGTTGCACCCAGCCACTGGGTGG No data
1185737434_1185737451 29 Left 1185737434 X:2503959-2503981 CCCCACAGAACCTCAACAGGCAC No data
Right 1185737451 X:2504011-2504033 CCCAGCCACTGGGTGGGCTCTGG No data
1185737434_1185737449 23 Left 1185737434 X:2503959-2503981 CCCCACAGAACCTCAACAGGCAC No data
Right 1185737449 X:2504005-2504027 GTTGCACCCAGCCACTGGGTGGG No data
1185737434_1185737446 18 Left 1185737434 X:2503959-2503981 CCCCACAGAACCTCAACAGGCAC No data
Right 1185737446 X:2504000-2504022 TGCAGGTTGCACCCAGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185737434 Original CRISPR GTGCCTGTTGAGGTTCTGTG GGG (reversed) Intergenic
No off target data available for this crispr