ID: 1185737435

View in Genome Browser
Species Human (GRCh38)
Location X:2503960-2503982
Sequence AGTGCCTGTTGAGGTTCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185737435_1185737448 21 Left 1185737435 X:2503960-2503982 CCCACAGAACCTCAACAGGCACT No data
Right 1185737448 X:2504004-2504026 GGTTGCACCCAGCCACTGGGTGG No data
1185737435_1185737451 28 Left 1185737435 X:2503960-2503982 CCCACAGAACCTCAACAGGCACT No data
Right 1185737451 X:2504011-2504033 CCCAGCCACTGGGTGGGCTCTGG No data
1185737435_1185737446 17 Left 1185737435 X:2503960-2503982 CCCACAGAACCTCAACAGGCACT No data
Right 1185737446 X:2504000-2504022 TGCAGGTTGCACCCAGCCACTGG No data
1185737435_1185737449 22 Left 1185737435 X:2503960-2503982 CCCACAGAACCTCAACAGGCACT No data
Right 1185737449 X:2504005-2504027 GTTGCACCCAGCCACTGGGTGGG No data
1185737435_1185737441 0 Left 1185737435 X:2503960-2503982 CCCACAGAACCTCAACAGGCACT No data
Right 1185737441 X:2503983-2504005 AAGGGGCACCCCCAGTGTGCAGG No data
1185737435_1185737447 18 Left 1185737435 X:2503960-2503982 CCCACAGAACCTCAACAGGCACT No data
Right 1185737447 X:2504001-2504023 GCAGGTTGCACCCAGCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185737435 Original CRISPR AGTGCCTGTTGAGGTTCTGT GGG (reversed) Intergenic
No off target data available for this crispr