ID: 1185737441

View in Genome Browser
Species Human (GRCh38)
Location X:2503983-2504005
Sequence AAGGGGCACCCCCAGTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185737430_1185737441 16 Left 1185737430 X:2503944-2503966 CCTCCAGGCCTCACTCCCCACAG No data
Right 1185737441 X:2503983-2504005 AAGGGGCACCCCCAGTGTGCAGG No data
1185737436_1185737441 -1 Left 1185737436 X:2503961-2503983 CCACAGAACCTCAACAGGCACTA No data
Right 1185737441 X:2503983-2504005 AAGGGGCACCCCCAGTGTGCAGG No data
1185737429_1185737441 17 Left 1185737429 X:2503943-2503965 CCCTCCAGGCCTCACTCCCCACA No data
Right 1185737441 X:2503983-2504005 AAGGGGCACCCCCAGTGTGCAGG No data
1185737435_1185737441 0 Left 1185737435 X:2503960-2503982 CCCACAGAACCTCAACAGGCACT No data
Right 1185737441 X:2503983-2504005 AAGGGGCACCCCCAGTGTGCAGG No data
1185737440_1185737441 -9 Left 1185737440 X:2503969-2503991 CCTCAACAGGCACTAAGGGGCAC No data
Right 1185737441 X:2503983-2504005 AAGGGGCACCCCCAGTGTGCAGG No data
1185737434_1185737441 1 Left 1185737434 X:2503959-2503981 CCCCACAGAACCTCAACAGGCAC No data
Right 1185737441 X:2503983-2504005 AAGGGGCACCCCCAGTGTGCAGG No data
1185737432_1185737441 8 Left 1185737432 X:2503952-2503974 CCTCACTCCCCACAGAACCTCAA No data
Right 1185737441 X:2503983-2504005 AAGGGGCACCCCCAGTGTGCAGG No data
1185737431_1185737441 13 Left 1185737431 X:2503947-2503969 CCAGGCCTCACTCCCCACAGAAC No data
Right 1185737441 X:2503983-2504005 AAGGGGCACCCCCAGTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185737441 Original CRISPR AAGGGGCACCCCCAGTGTGC AGG Intergenic
No off target data available for this crispr