ID: 1185737442

View in Genome Browser
Species Human (GRCh38)
Location X:2503991-2504013
Sequence GGGTGCAACCTGCACACTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185737442_1185737449 -9 Left 1185737442 X:2503991-2504013 CCCCCAGTGTGCAGGTTGCACCC No data
Right 1185737449 X:2504005-2504027 GTTGCACCCAGCCACTGGGTGGG No data
1185737442_1185737448 -10 Left 1185737442 X:2503991-2504013 CCCCCAGTGTGCAGGTTGCACCC No data
Right 1185737448 X:2504004-2504026 GGTTGCACCCAGCCACTGGGTGG No data
1185737442_1185737451 -3 Left 1185737442 X:2503991-2504013 CCCCCAGTGTGCAGGTTGCACCC No data
Right 1185737451 X:2504011-2504033 CCCAGCCACTGGGTGGGCTCTGG No data
1185737442_1185737454 17 Left 1185737442 X:2503991-2504013 CCCCCAGTGTGCAGGTTGCACCC No data
Right 1185737454 X:2504031-2504053 TGGTGCAGATCTAAGATGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185737442 Original CRISPR GGGTGCAACCTGCACACTGG GGG (reversed) Intergenic
No off target data available for this crispr