ID: 1185737446

View in Genome Browser
Species Human (GRCh38)
Location X:2504000-2504022
Sequence TGCAGGTTGCACCCAGCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185737432_1185737446 25 Left 1185737432 X:2503952-2503974 CCTCACTCCCCACAGAACCTCAA No data
Right 1185737446 X:2504000-2504022 TGCAGGTTGCACCCAGCCACTGG No data
1185737435_1185737446 17 Left 1185737435 X:2503960-2503982 CCCACAGAACCTCAACAGGCACT No data
Right 1185737446 X:2504000-2504022 TGCAGGTTGCACCCAGCCACTGG No data
1185737436_1185737446 16 Left 1185737436 X:2503961-2503983 CCACAGAACCTCAACAGGCACTA No data
Right 1185737446 X:2504000-2504022 TGCAGGTTGCACCCAGCCACTGG No data
1185737440_1185737446 8 Left 1185737440 X:2503969-2503991 CCTCAACAGGCACTAAGGGGCAC No data
Right 1185737446 X:2504000-2504022 TGCAGGTTGCACCCAGCCACTGG No data
1185737434_1185737446 18 Left 1185737434 X:2503959-2503981 CCCCACAGAACCTCAACAGGCAC No data
Right 1185737446 X:2504000-2504022 TGCAGGTTGCACCCAGCCACTGG No data
1185737431_1185737446 30 Left 1185737431 X:2503947-2503969 CCAGGCCTCACTCCCCACAGAAC No data
Right 1185737446 X:2504000-2504022 TGCAGGTTGCACCCAGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185737446 Original CRISPR TGCAGGTTGCACCCAGCCAC TGG Intergenic
No off target data available for this crispr