ID: 1185737454

View in Genome Browser
Species Human (GRCh38)
Location X:2504031-2504053
Sequence TGGTGCAGATCTAAGATGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185737444_1185737454 15 Left 1185737444 X:2503993-2504015 CCCAGTGTGCAGGTTGCACCCAG No data
Right 1185737454 X:2504031-2504053 TGGTGCAGATCTAAGATGATTGG No data
1185737450_1185737454 -3 Left 1185737450 X:2504011-2504033 CCCAGCCACTGGGTGGGCTCTGG No data
Right 1185737454 X:2504031-2504053 TGGTGCAGATCTAAGATGATTGG No data
1185737452_1185737454 -4 Left 1185737452 X:2504012-2504034 CCAGCCACTGGGTGGGCTCTGGT No data
Right 1185737454 X:2504031-2504053 TGGTGCAGATCTAAGATGATTGG No data
1185737442_1185737454 17 Left 1185737442 X:2503991-2504013 CCCCCAGTGTGCAGGTTGCACCC No data
Right 1185737454 X:2504031-2504053 TGGTGCAGATCTAAGATGATTGG No data
1185737445_1185737454 14 Left 1185737445 X:2503994-2504016 CCAGTGTGCAGGTTGCACCCAGC No data
Right 1185737454 X:2504031-2504053 TGGTGCAGATCTAAGATGATTGG No data
1185737443_1185737454 16 Left 1185737443 X:2503992-2504014 CCCCAGTGTGCAGGTTGCACCCA No data
Right 1185737454 X:2504031-2504053 TGGTGCAGATCTAAGATGATTGG No data
1185737453_1185737454 -8 Left 1185737453 X:2504016-2504038 CCACTGGGTGGGCTCTGGTGCAG No data
Right 1185737454 X:2504031-2504053 TGGTGCAGATCTAAGATGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185737454 Original CRISPR TGGTGCAGATCTAAGATGAT TGG Intergenic
No off target data available for this crispr