ID: 1185741837

View in Genome Browser
Species Human (GRCh38)
Location X:2539816-2539838
Sequence ATTCCATGACTAATTGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185741837_1185741838 -6 Left 1185741837 X:2539816-2539838 CCTTGTTCAATTAGTCATGGAAT No data
Right 1185741838 X:2539833-2539855 TGGAATTTGAACACTGATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185741837 Original CRISPR ATTCCATGACTAATTGAACA AGG (reversed) Intergenic
No off target data available for this crispr