ID: 1185746614

View in Genome Browser
Species Human (GRCh38)
Location X:2578441-2578463
Sequence ATGTGGATTTGGAGCTAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185746614_1185746623 24 Left 1185746614 X:2578441-2578463 CCCTCCTAGCTCCAAATCCACAT No data
Right 1185746623 X:2578488-2578510 TGGGATTTAGCTTAACACTGTGG No data
1185746614_1185746619 4 Left 1185746614 X:2578441-2578463 CCCTCCTAGCTCCAAATCCACAT No data
Right 1185746619 X:2578468-2578490 TTCCCACTTCACTTTCTAAGTGG No data
1185746614_1185746620 5 Left 1185746614 X:2578441-2578463 CCCTCCTAGCTCCAAATCCACAT No data
Right 1185746620 X:2578469-2578491 TCCCACTTCACTTTCTAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185746614 Original CRISPR ATGTGGATTTGGAGCTAGGA GGG (reversed) Intergenic
No off target data available for this crispr