ID: 1185747472

View in Genome Browser
Species Human (GRCh38)
Location X:2584230-2584252
Sequence CGGGGCCGGCGCGGGGCTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185747472_1185747483 6 Left 1185747472 X:2584230-2584252 CCCGGAGCCCCGCGCCGGCCCCG No data
Right 1185747483 X:2584259-2584281 ATCCGCAATGCTCCGTGCCCGGG No data
1185747472_1185747482 5 Left 1185747472 X:2584230-2584252 CCCGGAGCCCCGCGCCGGCCCCG No data
Right 1185747482 X:2584258-2584280 CATCCGCAATGCTCCGTGCCCGG No data
1185747472_1185747487 22 Left 1185747472 X:2584230-2584252 CCCGGAGCCCCGCGCCGGCCCCG No data
Right 1185747487 X:2584275-2584297 GCCCGGGACAGACGCTGCCTGGG No data
1185747472_1185747490 25 Left 1185747472 X:2584230-2584252 CCCGGAGCCCCGCGCCGGCCCCG No data
Right 1185747490 X:2584278-2584300 CGGGACAGACGCTGCCTGGGTGG No data
1185747472_1185747486 21 Left 1185747472 X:2584230-2584252 CCCGGAGCCCCGCGCCGGCCCCG No data
Right 1185747486 X:2584274-2584296 TGCCCGGGACAGACGCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185747472 Original CRISPR CGGGGCCGGCGCGGGGCTCC GGG (reversed) Intergenic
No off target data available for this crispr