ID: 1185747888

View in Genome Browser
Species Human (GRCh38)
Location X:2586061-2586083
Sequence CTCCCACCTGTGTCATCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185747888_1185747898 26 Left 1185747888 X:2586061-2586083 CCCCAGGATGACACAGGTGGGAG No data
Right 1185747898 X:2586110-2586132 CAAAGAGAAGAGCCCACCTCAGG No data
1185747888_1185747894 3 Left 1185747888 X:2586061-2586083 CCCCAGGATGACACAGGTGGGAG No data
Right 1185747894 X:2586087-2586109 GGAGACCCTCTTCCTGCTGACGG No data
1185747888_1185747899 27 Left 1185747888 X:2586061-2586083 CCCCAGGATGACACAGGTGGGAG No data
Right 1185747899 X:2586111-2586133 AAAGAGAAGAGCCCACCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185747888 Original CRISPR CTCCCACCTGTGTCATCCTG GGG (reversed) Intergenic
No off target data available for this crispr