ID: 1185749201

View in Genome Browser
Species Human (GRCh38)
Location X:2597161-2597183
Sequence TTGTGTTTGGGGAGGGTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185749188_1185749201 19 Left 1185749188 X:2597119-2597141 CCCCAAAGCAGACCTTGAGACCG No data
Right 1185749201 X:2597161-2597183 TTGTGTTTGGGGAGGGTGGGCGG No data
1185749191_1185749201 7 Left 1185749191 X:2597131-2597153 CCTTGAGACCGTGATTTTACCGC No data
Right 1185749201 X:2597161-2597183 TTGTGTTTGGGGAGGGTGGGCGG No data
1185749190_1185749201 17 Left 1185749190 X:2597121-2597143 CCAAAGCAGACCTTGAGACCGTG No data
Right 1185749201 X:2597161-2597183 TTGTGTTTGGGGAGGGTGGGCGG No data
1185749189_1185749201 18 Left 1185749189 X:2597120-2597142 CCCAAAGCAGACCTTGAGACCGT No data
Right 1185749201 X:2597161-2597183 TTGTGTTTGGGGAGGGTGGGCGG No data
1185749192_1185749201 -1 Left 1185749192 X:2597139-2597161 CCGTGATTTTACCGCAAAGCTTT No data
Right 1185749201 X:2597161-2597183 TTGTGTTTGGGGAGGGTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185749201 Original CRISPR TTGTGTTTGGGGAGGGTGGG CGG Intergenic
No off target data available for this crispr