ID: 1185750804

View in Genome Browser
Species Human (GRCh38)
Location X:2608851-2608873
Sequence CCCAGGCAGCCCCAACGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185750804_1185750818 5 Left 1185750804 X:2608851-2608873 CCTCCCCGTTGGGGCTGCCTGGG No data
Right 1185750818 X:2608879-2608901 TGCCTGTTAGGAACAGAGAGGGG No data
1185750804_1185750816 3 Left 1185750804 X:2608851-2608873 CCTCCCCGTTGGGGCTGCCTGGG No data
Right 1185750816 X:2608877-2608899 GGTGCCTGTTAGGAACAGAGAGG No data
1185750804_1185750820 14 Left 1185750804 X:2608851-2608873 CCTCCCCGTTGGGGCTGCCTGGG No data
Right 1185750820 X:2608888-2608910 GGAACAGAGAGGGGACAGCAAGG No data
1185750804_1185750817 4 Left 1185750804 X:2608851-2608873 CCTCCCCGTTGGGGCTGCCTGGG No data
Right 1185750817 X:2608878-2608900 GTGCCTGTTAGGAACAGAGAGGG No data
1185750804_1185750825 29 Left 1185750804 X:2608851-2608873 CCTCCCCGTTGGGGCTGCCTGGG No data
Right 1185750825 X:2608903-2608925 CAGCAAGGGCGGGCGCGGAGAGG No data
1185750804_1185750821 15 Left 1185750804 X:2608851-2608873 CCTCCCCGTTGGGGCTGCCTGGG No data
Right 1185750821 X:2608889-2608911 GAACAGAGAGGGGACAGCAAGGG No data
1185750804_1185750814 -7 Left 1185750804 X:2608851-2608873 CCTCCCCGTTGGGGCTGCCTGGG No data
Right 1185750814 X:2608867-2608889 GCCTGGGGGGGGTGCCTGTTAGG No data
1185750804_1185750822 18 Left 1185750804 X:2608851-2608873 CCTCCCCGTTGGGGCTGCCTGGG No data
Right 1185750822 X:2608892-2608914 CAGAGAGGGGACAGCAAGGGCGG No data
1185750804_1185750824 24 Left 1185750804 X:2608851-2608873 CCTCCCCGTTGGGGCTGCCTGGG No data
Right 1185750824 X:2608898-2608920 GGGGACAGCAAGGGCGGGCGCGG No data
1185750804_1185750823 19 Left 1185750804 X:2608851-2608873 CCTCCCCGTTGGGGCTGCCTGGG No data
Right 1185750823 X:2608893-2608915 AGAGAGGGGACAGCAAGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185750804 Original CRISPR CCCAGGCAGCCCCAACGGGG AGG (reversed) Intergenic