ID: 1185750808

View in Genome Browser
Species Human (GRCh38)
Location X:2608854-2608876
Sequence CCCCCCAGGCAGCCCCAACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185750808_1185750814 -10 Left 1185750808 X:2608854-2608876 CCCCGTTGGGGCTGCCTGGGGGG No data
Right 1185750814 X:2608867-2608889 GCCTGGGGGGGGTGCCTGTTAGG No data
1185750808_1185750823 16 Left 1185750808 X:2608854-2608876 CCCCGTTGGGGCTGCCTGGGGGG No data
Right 1185750823 X:2608893-2608915 AGAGAGGGGACAGCAAGGGCGGG No data
1185750808_1185750817 1 Left 1185750808 X:2608854-2608876 CCCCGTTGGGGCTGCCTGGGGGG No data
Right 1185750817 X:2608878-2608900 GTGCCTGTTAGGAACAGAGAGGG No data
1185750808_1185750816 0 Left 1185750808 X:2608854-2608876 CCCCGTTGGGGCTGCCTGGGGGG No data
Right 1185750816 X:2608877-2608899 GGTGCCTGTTAGGAACAGAGAGG No data
1185750808_1185750822 15 Left 1185750808 X:2608854-2608876 CCCCGTTGGGGCTGCCTGGGGGG No data
Right 1185750822 X:2608892-2608914 CAGAGAGGGGACAGCAAGGGCGG No data
1185750808_1185750824 21 Left 1185750808 X:2608854-2608876 CCCCGTTGGGGCTGCCTGGGGGG No data
Right 1185750824 X:2608898-2608920 GGGGACAGCAAGGGCGGGCGCGG No data
1185750808_1185750821 12 Left 1185750808 X:2608854-2608876 CCCCGTTGGGGCTGCCTGGGGGG No data
Right 1185750821 X:2608889-2608911 GAACAGAGAGGGGACAGCAAGGG No data
1185750808_1185750825 26 Left 1185750808 X:2608854-2608876 CCCCGTTGGGGCTGCCTGGGGGG No data
Right 1185750825 X:2608903-2608925 CAGCAAGGGCGGGCGCGGAGAGG No data
1185750808_1185750820 11 Left 1185750808 X:2608854-2608876 CCCCGTTGGGGCTGCCTGGGGGG No data
Right 1185750820 X:2608888-2608910 GGAACAGAGAGGGGACAGCAAGG No data
1185750808_1185750818 2 Left 1185750808 X:2608854-2608876 CCCCGTTGGGGCTGCCTGGGGGG No data
Right 1185750818 X:2608879-2608901 TGCCTGTTAGGAACAGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185750808 Original CRISPR CCCCCCAGGCAGCCCCAACG GGG (reversed) Intergenic
No off target data available for this crispr