ID: 1185750814

View in Genome Browser
Species Human (GRCh38)
Location X:2608867-2608889
Sequence GCCTGGGGGGGGTGCCTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185750804_1185750814 -7 Left 1185750804 X:2608851-2608873 CCTCCCCGTTGGGGCTGCCTGGG No data
Right 1185750814 X:2608867-2608889 GCCTGGGGGGGGTGCCTGTTAGG No data
1185750799_1185750814 23 Left 1185750799 X:2608821-2608843 CCGAGCAGAGGAGCAGGAAGAGT No data
Right 1185750814 X:2608867-2608889 GCCTGGGGGGGGTGCCTGTTAGG No data
1185750808_1185750814 -10 Left 1185750808 X:2608854-2608876 CCCCGTTGGGGCTGCCTGGGGGG No data
Right 1185750814 X:2608867-2608889 GCCTGGGGGGGGTGCCTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185750814 Original CRISPR GCCTGGGGGGGGTGCCTGTT AGG Intergenic
No off target data available for this crispr