ID: 1185750815

View in Genome Browser
Species Human (GRCh38)
Location X:2608868-2608890
Sequence TCCTAACAGGCACCCCCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185750815_1185750823 2 Left 1185750815 X:2608868-2608890 CCTGGGGGGGGTGCCTGTTAGGA No data
Right 1185750823 X:2608893-2608915 AGAGAGGGGACAGCAAGGGCGGG No data
1185750815_1185750825 12 Left 1185750815 X:2608868-2608890 CCTGGGGGGGGTGCCTGTTAGGA No data
Right 1185750825 X:2608903-2608925 CAGCAAGGGCGGGCGCGGAGAGG No data
1185750815_1185750822 1 Left 1185750815 X:2608868-2608890 CCTGGGGGGGGTGCCTGTTAGGA No data
Right 1185750822 X:2608892-2608914 CAGAGAGGGGACAGCAAGGGCGG No data
1185750815_1185750824 7 Left 1185750815 X:2608868-2608890 CCTGGGGGGGGTGCCTGTTAGGA No data
Right 1185750824 X:2608898-2608920 GGGGACAGCAAGGGCGGGCGCGG No data
1185750815_1185750820 -3 Left 1185750815 X:2608868-2608890 CCTGGGGGGGGTGCCTGTTAGGA No data
Right 1185750820 X:2608888-2608910 GGAACAGAGAGGGGACAGCAAGG No data
1185750815_1185750821 -2 Left 1185750815 X:2608868-2608890 CCTGGGGGGGGTGCCTGTTAGGA No data
Right 1185750821 X:2608889-2608911 GAACAGAGAGGGGACAGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185750815 Original CRISPR TCCTAACAGGCACCCCCCCC AGG (reversed) Intergenic
No off target data available for this crispr