ID: 1185750819

View in Genome Browser
Species Human (GRCh38)
Location X:2608881-2608903
Sequence GTCCCCTCTCTGTTCCTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185750819_1185750824 -6 Left 1185750819 X:2608881-2608903 CCTGTTAGGAACAGAGAGGGGAC No data
Right 1185750824 X:2608898-2608920 GGGGACAGCAAGGGCGGGCGCGG No data
1185750819_1185750825 -1 Left 1185750819 X:2608881-2608903 CCTGTTAGGAACAGAGAGGGGAC No data
Right 1185750825 X:2608903-2608925 CAGCAAGGGCGGGCGCGGAGAGG No data
1185750819_1185750826 19 Left 1185750819 X:2608881-2608903 CCTGTTAGGAACAGAGAGGGGAC No data
Right 1185750826 X:2608923-2608945 AGGCCCACACCTCTCCAAGAAGG No data
1185750819_1185750830 26 Left 1185750819 X:2608881-2608903 CCTGTTAGGAACAGAGAGGGGAC No data
Right 1185750830 X:2608930-2608952 CACCTCTCCAAGAAGGGCAGCGG No data
1185750819_1185750827 20 Left 1185750819 X:2608881-2608903 CCTGTTAGGAACAGAGAGGGGAC No data
Right 1185750827 X:2608924-2608946 GGCCCACACCTCTCCAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185750819 Original CRISPR GTCCCCTCTCTGTTCCTAAC AGG (reversed) Intergenic
No off target data available for this crispr