ID: 1185750821

View in Genome Browser
Species Human (GRCh38)
Location X:2608889-2608911
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185750812_1185750821 10 Left 1185750812 X:2608856-2608878 CCGTTGGGGCTGCCTGGGGGGGG No data
Right 1185750821 X:2608889-2608911 GAACAGAGAGGGGACAGCAAGGG No data
1185750815_1185750821 -2 Left 1185750815 X:2608868-2608890 CCTGGGGGGGGTGCCTGTTAGGA No data
Right 1185750821 X:2608889-2608911 GAACAGAGAGGGGACAGCAAGGG No data
1185750808_1185750821 12 Left 1185750808 X:2608854-2608876 CCCCGTTGGGGCTGCCTGGGGGG No data
Right 1185750821 X:2608889-2608911 GAACAGAGAGGGGACAGCAAGGG No data
1185750804_1185750821 15 Left 1185750804 X:2608851-2608873 CCTCCCCGTTGGGGCTGCCTGGG No data
Right 1185750821 X:2608889-2608911 GAACAGAGAGGGGACAGCAAGGG No data
1185750810_1185750821 11 Left 1185750810 X:2608855-2608877 CCCGTTGGGGCTGCCTGGGGGGG No data
Right 1185750821 X:2608889-2608911 GAACAGAGAGGGGACAGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185750821 Original CRISPR GAACAGAGAGGGGACAGCAA GGG Intergenic