ID: 1185753446

View in Genome Browser
Species Human (GRCh38)
Location X:2632826-2632848
Sequence CTCCCATGTGGTTTTGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185753436_1185753446 18 Left 1185753436 X:2632785-2632807 CCTATCCCATGGATTTGCCTATC No data
Right 1185753446 X:2632826-2632848 CTCCCATGTGGTTTTGTGCCTGG No data
1185753441_1185753446 12 Left 1185753441 X:2632791-2632813 CCATGGATTTGCCTATCAGGGGC No data
Right 1185753446 X:2632826-2632848 CTCCCATGTGGTTTTGTGCCTGG No data
1185753442_1185753446 1 Left 1185753442 X:2632802-2632824 CCTATCAGGGGCATTTCAAACGG No data
Right 1185753446 X:2632826-2632848 CTCCCATGTGGTTTTGTGCCTGG No data
1185753439_1185753446 13 Left 1185753439 X:2632790-2632812 CCCATGGATTTGCCTATCAGGGG No data
Right 1185753446 X:2632826-2632848 CTCCCATGTGGTTTTGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185753446 Original CRISPR CTCCCATGTGGTTTTGTGCC TGG Intergenic
No off target data available for this crispr