ID: 1185758892

View in Genome Browser
Species Human (GRCh38)
Location X:2674109-2674131
Sequence ATGTGTGAGCAAAGGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185758892_1185758899 26 Left 1185758892 X:2674109-2674131 CCTTCCTGCCTTTGCTCACACAT No data
Right 1185758899 X:2674158-2674180 TTTTTAATTTCAATTGTTTTGGG No data
1185758892_1185758901 28 Left 1185758892 X:2674109-2674131 CCTTCCTGCCTTTGCTCACACAT No data
Right 1185758901 X:2674160-2674182 TTTAATTTCAATTGTTTTGGGGG No data
1185758892_1185758900 27 Left 1185758892 X:2674109-2674131 CCTTCCTGCCTTTGCTCACACAT No data
Right 1185758900 X:2674159-2674181 TTTTAATTTCAATTGTTTTGGGG No data
1185758892_1185758898 25 Left 1185758892 X:2674109-2674131 CCTTCCTGCCTTTGCTCACACAT No data
Right 1185758898 X:2674157-2674179 TTTTTTAATTTCAATTGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185758892 Original CRISPR ATGTGTGAGCAAAGGCAGGA AGG (reversed) Intergenic
No off target data available for this crispr