ID: 1185762670

View in Genome Browser
Species Human (GRCh38)
Location X:2700597-2700619
Sequence GTGCATTAACGGATGGATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 99}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185762670 Original CRISPR GTGCATTAACGGATGGATAA AGG (reversed) Intronic
900498136 1:2985870-2985892 GTGAATGAATGGATGGATGATGG - Intergenic
903025105 1:20423062-20423084 GTGCATCAACATATGCATAATGG + Intergenic
903028139 1:20443964-20443986 GTGCATGCACTGGTGGATAAGGG - Intergenic
903937626 1:26907494-26907516 ATGAATTAATGGATGGATAGTGG + Intronic
911246638 1:95525427-95525449 GTGCATGAGCTGTTGGATAATGG + Intergenic
913623320 1:120633603-120633625 GTGGATTAACAAATGAATAAGGG + Intergenic
922580767 1:226696076-226696098 GGGCATTAATGGGTGGGTAATGG - Intronic
1063438926 10:6056287-6056309 ATGCATGAATGGATGGATGAAGG + Intronic
1071104382 10:82077703-82077725 GAGCATTAGATGATGGATAATGG + Intronic
1074757596 10:116636622-116636644 GTAGATGAAAGGATGGATAAGGG + Intronic
1075143078 10:119857809-119857831 GTGAATTAACGGACTGATATTGG - Intronic
1078308185 11:10212128-10212150 GTCCATTAACCCATGGATATGGG + Intronic
1083274682 11:61590081-61590103 GTGCATTAACAGGTGGATTCAGG + Intergenic
1084554757 11:69869033-69869055 GTGCATCCCCGGATTGATAAAGG - Intergenic
1084841126 11:71849383-71849405 GTTTATGAACAGATGGATAAAGG - Intergenic
1088596546 11:111445264-111445286 CTGCATTAACTGCTGGATTAGGG - Intronic
1089644544 11:119869982-119870004 GGGCAGTAACAGAAGGATAAGGG - Intergenic
1090140976 11:124261177-124261199 GTGGATGGATGGATGGATAAAGG - Intergenic
1092602188 12:10079273-10079295 GTGGATGGATGGATGGATAATGG + Intronic
1101011700 12:100457430-100457452 GTGAATTAATGGATGAATTAGGG + Intergenic
1104896361 12:132166864-132166886 GTGGATGGACGGATGGATGATGG - Intergenic
1104896439 12:132167148-132167170 GTGGATGAATGGATGGATAAGGG - Intergenic
1106057219 13:26249694-26249716 ATGAATGAACAGATGGATAATGG - Intergenic
1120301435 14:82712403-82712425 GTGGATTCACGGATTAATAATGG - Intergenic
1124395756 15:29300133-29300155 GTGAGTAAATGGATGGATAATGG + Intronic
1124849914 15:33326275-33326297 GTGGATGGACGGATGAATAAGGG - Intronic
1130347788 15:83065428-83065450 TTCCATTGACGAATGGATAAAGG - Intronic
1137386165 16:48044316-48044338 GTGGATCAATGGATGGATGATGG - Intergenic
1137977060 16:53040985-53041007 GTGGATGGATGGATGGATAATGG + Intergenic
1138827504 16:60338179-60338201 GTGGATTGAAGGATGGAAAATGG + Intergenic
1139541396 16:67619944-67619966 GGGGACTAAAGGATGGATAATGG + Intronic
1149295322 17:55256860-55256882 ATGCATTAACAGATGGGGAATGG + Intergenic
1151922557 17:77168426-77168448 TTGCATTAACCCATGGATACAGG + Intronic
1154307969 18:13244153-13244175 GTGGATGAATGGATGGATAGAGG - Intronic
1154396273 18:13992744-13992766 GTGCTTTGACTGATGGATAGAGG - Intergenic
1155075752 18:22352830-22352852 GTTCATTACCAGATGGATGAAGG - Intergenic
1155430764 18:25754617-25754639 GTCCATCAACAGATGAATAAAGG + Intergenic
1159614104 18:70560327-70560349 GTCTATCAACAGATGGATAAAGG + Intergenic
1160502561 18:79409525-79409547 GTGGATGAATGGATGGATGATGG - Intronic
1160687110 19:442247-442269 GTGGGTGAACGGATGGATGATGG + Intronic
1163383546 19:16985272-16985294 GTGGATGAATGGATGGATGAAGG + Intronic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
928923143 2:36547370-36547392 CTTCATTAACCAATGGATAATGG - Intronic
930497794 2:52170927-52170949 GTTCATTAAGGGTTGGATAGAGG + Intergenic
932145815 2:69315630-69315652 GTCCATCAACGAATGAATAAAGG - Intergenic
936057715 2:109273365-109273387 GAGCCTTAACGCATGGATGAGGG + Intronic
936614533 2:114034995-114035017 GTCCATTTATGGATGAATAAAGG - Intergenic
944590847 2:201216672-201216694 GAGCATTAAAGGATGTATATTGG - Intronic
945000685 2:205346845-205346867 ATGCATGAACTGAAGGATAATGG - Intronic
949065795 2:241989759-241989781 GTGGATGGATGGATGGATAATGG - Intergenic
1169012429 20:2261544-2261566 ATGAAATAATGGATGGATAAGGG - Intergenic
1169250052 20:4053303-4053325 GTCCATCAATGAATGGATAAAGG + Intergenic
1175165266 20:57039088-57039110 ATGAATAAATGGATGGATAATGG + Intergenic
1175393445 20:58642324-58642346 GTGCCTTGAAGGATGGAAAAGGG - Intergenic
1175515895 20:59569560-59569582 GTGGATGGACGGATGGATGATGG + Intergenic
1175754158 20:61518807-61518829 ATGGATTAATGGATGGATGATGG - Intronic
1179474765 21:41636110-41636132 GTGGATGAATGGATGGATGATGG - Intergenic
1179623705 21:42635164-42635186 GTGGATGAACAGATGGACAATGG - Intergenic
1183266752 22:36831993-36832015 GTGCATGGATGGATGGATGACGG + Intergenic
1183304009 22:37072368-37072390 GTGCATGGATGGATGGATGATGG + Intronic
1184653345 22:45929349-45929371 GTGAATAGATGGATGGATAAAGG - Intronic
951707701 3:25559806-25559828 GTGGATCAATGGATGGAAAATGG + Intronic
958871464 3:99563843-99563865 ATGTATTAACGGATTGGTAAGGG + Intergenic
960467332 3:118013526-118013548 GTGCACTAACAGAAGGAGAAGGG + Intergenic
967038259 3:185664496-185664518 GTGAATTAATGGAGGGAGAAGGG + Intronic
969782223 4:9415409-9415431 GTTTATGAACAGATGGATAAAGG - Intergenic
974512297 4:62858940-62858962 GTTCATTATCTGATGAATAAAGG - Intergenic
975412560 4:74070897-74070919 GTGCTTTTAGGGATGGCTAATGG - Intergenic
975730536 4:77333417-77333439 TTGCATTAACCCATGGATACGGG + Intronic
978706098 4:111713572-111713594 CTGCATTCAGGGATGGAAAAGGG + Intergenic
980844517 4:138307988-138308010 CTGCATTCACGGATGGGAAATGG - Intergenic
983555464 4:169055496-169055518 GGGCATTAAAGGTTGGATAGGGG + Intergenic
987927172 5:24357186-24357208 GTGCATTACTGTATAGATAATGG - Intergenic
994717886 5:103345960-103345982 ATGCAAAAACAGATGGATAATGG - Intergenic
995618722 5:113998685-113998707 GGGCTTTAATTGATGGATAATGG + Intergenic
1000521310 5:162298202-162298224 GGGCATTATCTGATGGACAAGGG - Intergenic
1002411333 5:179079698-179079720 GTTCATTAAAGGATGAATACTGG - Exonic
1002819944 6:715599-715621 ATGCATAAACAGATGGAAAATGG + Intergenic
1008543965 6:52569481-52569503 ATGCAATAACGTATGTATAAGGG + Intronic
1025138298 7:56439425-56439447 GAGAATTAAGGGATGGAAAAAGG + Intergenic
1026418300 7:70206146-70206168 GTGCATTAACGGAGGGGGACAGG - Intronic
1028700385 7:93772049-93772071 GGGCAATAAGGGATGGAGAAAGG + Intronic
1033642702 7:143277563-143277585 ATGCATTGATGGATGGATAAAGG + Intergenic
1036836907 8:12079034-12079056 GTTTATGAACAGATGGATAAAGG + Intergenic
1036858699 8:12325280-12325302 GTTTATGAACAGATGGATAAAGG + Intergenic
1037869005 8:22473765-22473787 GAGCATAAAAGAATGGATAAGGG - Intronic
1041639859 8:60185334-60185356 GTGCATTAATACATGCATAATGG + Intergenic
1046041974 8:108916658-108916680 GTGAATTAACAAATGGATGAAGG - Intergenic
1046392975 8:113601362-113601384 GTGCATTAATGAATGAATAAAGG - Intronic
1048617668 8:136095651-136095673 TTGCATTAATAGATGGATGATGG + Intergenic
1055027982 9:71742795-71742817 GTACATTAAGAGATGGATCAAGG + Intronic
1056454879 9:86750773-86750795 TTGCATTAACGTATGGAAAATGG - Intergenic
1057082630 9:92184424-92184446 ATGGATAAATGGATGGATAATGG - Intergenic
1057821622 9:98335837-98335859 GTGCATGAATGAATGGATGATGG - Intronic
1059849235 9:118318709-118318731 ATGGATCAACGGATGGAAAAAGG + Intergenic
1062284924 9:135768599-135768621 GTGCATTGCAGGATGGACAATGG + Exonic
1185616429 X:1424687-1424709 GTGGATGACTGGATGGATAAAGG - Intronic
1185762670 X:2700597-2700619 GTGCATTAACGGATGGATAAAGG - Intronic
1186283801 X:8022812-8022834 GTGTCTTAACAGATAGATAAGGG + Intergenic
1189024458 X:37377544-37377566 GTGCATTAACAAGAGGATAATGG - Intronic
1192756755 X:74054681-74054703 GTGCACTAACGTATACATAATGG - Intergenic
1193735906 X:85155951-85155973 GTGTACTAATGGATAGATAAAGG + Intergenic
1197164753 X:123364721-123364743 GTCCATGAACAAATGGATAAAGG + Intronic
1201917383 Y:19196693-19196715 ATGGATTAATGGATGGATGATGG + Intergenic