ID: 1185766790

View in Genome Browser
Species Human (GRCh38)
Location X:2732231-2732253
Sequence TGTTGGCTTCGCGGGGGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 4, 3: 5, 4: 80}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185766790 Original CRISPR TGTTGGCTTCGCGGGGGACC TGG Intronic
906508526 1:46397518-46397540 TGTAGGCTTTGCGGGGGAGTAGG + Intronic
906716005 1:47969811-47969833 TGCTGGCTTCACCTGGGACCAGG - Intronic
914274590 1:146112057-146112079 TGTTGGCTTCGCTGTTGACATGG - Intronic
914275123 1:146116775-146116797 TGTTGGCTTCGCTGTTGACATGG - Intronic
1063929474 10:11014950-11014972 TGTTGCCATCACTGGGGACCAGG - Intronic
1066702300 10:38143086-38143108 TGTGGGCTGCCAGGGGGACCTGG - Intergenic
1067233536 10:44427890-44427912 TGTTGGCATTGAGGGAGACCAGG - Intergenic
1070768282 10:79068648-79068670 TGGTGGCGTAGCGGGGAACCAGG + Intergenic
1077535204 11:3120685-3120707 TGATGGCTTGGCGGGGAGCCAGG + Intronic
1078550390 11:12276143-12276165 TGCTGTCTTCGCTGGTGACCAGG - Intronic
1081730651 11:45369661-45369683 TGTGGGCTTCGCTGGGGATTGGG + Intergenic
1083528830 11:63397987-63398009 TGCTGGCTTCAGGTGGGACCTGG - Intronic
1083936640 11:65872938-65872960 TGGCGGCGCCGCGGGGGACCGGG - Intronic
1091316972 11:134621326-134621348 TGTTGGGTTGGCTGTGGACCTGG + Intergenic
1092230811 12:6774316-6774338 GGTGGGCTTCGCGGGGTTCCAGG + Intronic
1092886269 12:12927016-12927038 AGTAGGCTTCGCGGTGGAGCAGG - Intergenic
1102709915 12:114916790-114916812 TGTTGGCTCTGCGGGGTAACAGG - Intergenic
1117690434 14:58299452-58299474 GGTCGTCTCCGCGGGGGACCTGG + Intronic
1119046269 14:71320948-71320970 GGCTGGCTCCGAGGGGGACCCGG - Intronic
1119178696 14:72588890-72588912 TGCTGGCTTGACGGGGCACCTGG - Intergenic
1119756717 14:77125029-77125051 TGTTGGCTGCGCGGGGACCGCGG - Intronic
1122624127 14:103075547-103075569 TGTCGGCTCCGCGCGGGCCCCGG + Intergenic
1122815481 14:104310076-104310098 CGTGGGCTTCACGTGGGACCTGG + Intergenic
1122905623 14:104800383-104800405 TGCTGGCTGCGCGCGGGGCCCGG + Intergenic
1124970925 15:34489465-34489487 TGATGGCTACGCTGTGGACCGGG - Intergenic
1128457002 15:67836719-67836741 TGTAGGCACCGCTGGGGACCAGG - Intergenic
1129184931 15:73900166-73900188 TGTTGGCTTTGCAGGAGCCCAGG - Intergenic
1132638226 16:964081-964103 TGTTGGCTGCTCGGGCGACACGG - Intronic
1132699405 16:1215954-1215976 TGTGGGCTCCGAGGGGGCCCCGG - Intronic
1136778892 16:32885281-32885303 TGTGGGCTTCGCCGTGGGCCTGG - Intergenic
1138265486 16:55656901-55656923 AGTCGGCTTCGCAGTGGACCTGG + Exonic
1139341003 16:66267804-66267826 TGTTGCCTTCGGGGGGACCCAGG - Intergenic
1141153324 16:81579617-81579639 TGTTGCCTTCAGGGGGGAGCAGG - Intronic
1141760773 16:86027097-86027119 TGGGGGCTTCGCGGGGGAGTGGG - Intergenic
1203081305 16_KI270728v1_random:1147370-1147392 TGTGGGCTTCGCCGTGGATCTGG - Intergenic
1145057695 17:19714251-19714273 TTTTAGCTTCACGGTGGACCTGG - Intronic
1149430543 17:56593436-56593458 TGTCGGCTTCCCGGGGCATCTGG + Intergenic
1153444467 18:5155868-5155890 TGGTGGCCTCCTGGGGGACCAGG + Intronic
1153942436 18:9989706-9989728 TGTGGGCTTGGCGGGGAGCCCGG + Intergenic
1155508244 18:26550994-26551016 TCCTGGCTTGGCAGGGGACCAGG + Intronic
1159346805 18:67216335-67216357 TCTTGGCTTTGCGGGAGCCCTGG + Intergenic
1161004792 19:1929849-1929871 TGCAGGCATGGCGGGGGACCTGG + Intergenic
1161533393 19:4803923-4803945 TGTTGGCATGGCTGGGGACTGGG + Intergenic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
1164554724 19:29242822-29242844 TTTTGACTTCGAGGGGGACCCGG - Intergenic
1165767836 19:38361976-38361998 TGGTGGGTGGGCGGGGGACCTGG + Intronic
927929837 2:27036997-27037019 TGTTGGCTTAGCTGGGGTCATGG + Intronic
1171448550 20:25221091-25221113 TGTTGCCTTCCCAGTGGACCTGG + Intronic
1176869744 21:14075219-14075241 TGTTGCCTTGGGGGTGGACCCGG - Intergenic
1184487215 22:44787132-44787154 CGTTGGCTTCTCGGAGCACCTGG - Intronic
951591175 3:24266661-24266683 TGTTGCCTTTGCTGGGGACCTGG - Intronic
962944742 3:140156912-140156934 TGTTTGCCTCTCGGAGGACCTGG + Intronic
966194115 3:177296998-177297020 TGCAGGCTTCATGGGGGACCAGG + Intergenic
986729708 5:10626153-10626175 GGTTGGCTCAGCAGGGGACCAGG - Intronic
993044443 5:82851615-82851637 TGTGGGTTTCGTTGGGGACCAGG + Intergenic
994178917 5:96742686-96742708 TGTCGGCTTCACTGGGCACCCGG + Exonic
997374256 5:133385509-133385531 TGTTGGGTTCTAGGGGGACCAGG - Intronic
998469787 5:142374770-142374792 TGTTAGCCTCACGGTGGACCTGG + Intergenic
999449743 5:151668965-151668987 TGTTGCCTTGGAGGGGGAGCAGG + Intronic
1003514338 6:6805679-6805701 AGTTGGCTTCACGGGGCAGCAGG - Intergenic
1006299072 6:33184288-33184310 TGTCGGCTGTGGGGGGGACCTGG + Intronic
1007184577 6:39958099-39958121 TGTTGGCTTTTTGGGGGACTGGG + Intergenic
1007766911 6:44166061-44166083 TGTTGGGATCTTGGGGGACCAGG + Intronic
1021974382 7:25997492-25997514 TATTGGCTTTGCGGGGGGCAGGG + Intergenic
1022374785 7:29803156-29803178 TGTTGGCTTCCTGGGGGGCAGGG + Intergenic
1023559595 7:41459903-41459925 TGTTGGCTGGGCAGGGCACCTGG - Intergenic
1023849902 7:44144792-44144814 TGTTGGCCTCGCCTGGGCCCAGG - Exonic
1029616887 7:101664809-101664831 TGCAGGCTTCGGGGGGGACCCGG + Intergenic
1031088262 7:117324049-117324071 TCTTGGCTGGGCGGGGGCCCAGG - Intergenic
1036185781 8:6621600-6621622 TGCTGGCCTGGCGGGGGACTTGG - Exonic
1037813755 8:22101449-22101471 TCTTGGCTTCCTCGGGGACCAGG - Exonic
1049164119 8:141116213-141116235 TGTTGGCTTCCCCGAGGACCTGG + Intergenic
1053607806 9:39678920-39678942 TGTTGGCTGCGCTGGGGACCTGG - Intergenic
1053865654 9:42435280-42435302 TGTTGGCTGCGCTGGGGACCTGG - Intergenic
1054245729 9:62663489-62663511 TGTTGGCTGCGCTGGGGACCTGG + Intergenic
1054559854 9:66698020-66698042 TGTTGGCTGCGCTGGGGACCTGG + Intergenic
1057817774 9:98308245-98308267 TGTGGGCTACTCTGGGGACCTGG + Intronic
1062474225 9:136719516-136719538 TCTTGGCCTCGCGAGGGCCCTGG - Intronic
1203761310 EBV:13869-13891 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203762239 EBV:16941-16963 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203763168 EBV:20013-20035 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203764097 EBV:23085-23107 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203765026 EBV:26157-26179 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203765955 EBV:29229-29251 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203766884 EBV:32301-32323 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1185754755 X:2644519-2644541 TGTGGGCATCTCTGGGGACCAGG + Intergenic
1185766790 X:2732231-2732253 TGTTGGCTTCGCGGGGGACCTGG + Intronic
1189303379 X:39969166-39969188 TGATGGCTTCACGGGAGGCCTGG - Intergenic
1192495817 X:71616213-71616235 GGGTGGCTTCCCGGGAGACCTGG + Exonic
1198816661 X:140598830-140598852 TTTTGACTGCGTGGGGGACCAGG + Intergenic