ID: 1185768688

View in Genome Browser
Species Human (GRCh38)
Location X:2748128-2748150
Sequence CCCAGGACTTTGAGAGCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185768688_1185768693 14 Left 1185768688 X:2748128-2748150 CCTCTGGCTCTCAAAGTCCTGGG No data
Right 1185768693 X:2748165-2748187 CCACGGTGCCCAGCCAAGAATGG No data
1185768688_1185768691 -3 Left 1185768688 X:2748128-2748150 CCTCTGGCTCTCAAAGTCCTGGG No data
Right 1185768691 X:2748148-2748170 GGGATTACAGACATGAGCCACGG 0: 71
1: 2073
2: 5012
3: 5137
4: 3445

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185768688 Original CRISPR CCCAGGACTTTGAGAGCCAG AGG (reversed) Intergenic
No off target data available for this crispr