ID: 1185768691

View in Genome Browser
Species Human (GRCh38)
Location X:2748148-2748170
Sequence GGGATTACAGACATGAGCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 15738
Summary {0: 71, 1: 2073, 2: 5012, 3: 5137, 4: 3445}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185768684_1185768691 15 Left 1185768684 X:2748110-2748132 CCTCAAGTGATCTGCCTGCCTCT 0: 160
1: 4842
2: 19612
3: 47417
4: 83142
Right 1185768691 X:2748148-2748170 GGGATTACAGACATGAGCCACGG 0: 71
1: 2073
2: 5012
3: 5137
4: 3445
1185768683_1185768691 20 Left 1185768683 X:2748105-2748127 CCTGGCCTCAAGTGATCTGCCTG 0: 1513
1: 9517
2: 33136
3: 75046
4: 131667
Right 1185768691 X:2748148-2748170 GGGATTACAGACATGAGCCACGG 0: 71
1: 2073
2: 5012
3: 5137
4: 3445
1185768686_1185768691 1 Left 1185768686 X:2748124-2748146 CCTGCCTCTGGCTCTCAAAGTCC No data
Right 1185768691 X:2748148-2748170 GGGATTACAGACATGAGCCACGG 0: 71
1: 2073
2: 5012
3: 5137
4: 3445
1185768688_1185768691 -3 Left 1185768688 X:2748128-2748150 CCTCTGGCTCTCAAAGTCCTGGG No data
Right 1185768691 X:2748148-2748170 GGGATTACAGACATGAGCCACGG 0: 71
1: 2073
2: 5012
3: 5137
4: 3445

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185768691 Original CRISPR GGGATTACAGACATGAGCCA CGG Intergenic
Too many off-targets to display for this crispr