ID: 1185768693

View in Genome Browser
Species Human (GRCh38)
Location X:2748165-2748187
Sequence CCACGGTGCCCAGCCAAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185768690_1185768693 -3 Left 1185768690 X:2748145-2748167 CCTGGGATTACAGACATGAGCCA 0: 54
1: 1409
2: 3298
3: 4113
4: 4183
Right 1185768693 X:2748165-2748187 CCACGGTGCCCAGCCAAGAATGG No data
1185768686_1185768693 18 Left 1185768686 X:2748124-2748146 CCTGCCTCTGGCTCTCAAAGTCC No data
Right 1185768693 X:2748165-2748187 CCACGGTGCCCAGCCAAGAATGG No data
1185768688_1185768693 14 Left 1185768688 X:2748128-2748150 CCTCTGGCTCTCAAAGTCCTGGG No data
Right 1185768693 X:2748165-2748187 CCACGGTGCCCAGCCAAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185768693 Original CRISPR CCACGGTGCCCAGCCAAGAA TGG Intergenic
No off target data available for this crispr