ID: 1185772411

View in Genome Browser
Species Human (GRCh38)
Location X:2774495-2774517
Sequence GGGCATCCTCACAGCCTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 164}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185772411 Original CRISPR GGGCATCCTCACAGCCTCAA GGG Intronic
900343334 1:2199033-2199055 CAGCCTCCTCACAGCCTCAGTGG + Intronic
901775873 1:11560179-11560201 GGGCATCCTCACCTCCCCCAGGG + Intergenic
903228552 1:21907591-21907613 GGGCCTCCTCAGAGCCTCCTAGG + Intronic
903229242 1:21911760-21911782 GGCCAAGCTCACAGCCTCCAGGG - Intronic
903374298 1:22856183-22856205 GGTGATCCTCAAAACCTCAATGG - Intronic
904263765 1:29306118-29306140 GGACAGCCTCACAGCAGCAAAGG - Intronic
905930503 1:41783534-41783556 GGGCAACCTCACAGCTACCAGGG + Intronic
906305498 1:44715959-44715981 GAGCATCCTCTCAGCTTCATGGG + Intronic
908562339 1:65319310-65319332 GGGCATCTGCACAGCCTAATGGG - Intronic
910490188 1:87760523-87760545 GGGTATCAGCACAGCCTGAATGG - Intergenic
912573703 1:110644333-110644355 GGGCTTCCTCACTTCCTCACTGG - Intergenic
920223953 1:204424608-204424630 CTGCAACCTCACAGCCTCCAAGG + Exonic
920433178 1:205931899-205931921 GTGCAGCCTCTCAGCCTCCATGG + Exonic
920947112 1:210539900-210539922 GGGCATTCTCAGATCATCAAGGG + Intronic
922809027 1:228405922-228405944 GGCCATGGTCCCAGCCTCAAGGG + Intronic
924424861 1:243941575-243941597 AGGAATCCTTACTGCCTCAACGG + Intergenic
1068017077 10:51530708-51530730 GGGCTTCCTGGCAGCCTCACTGG - Intronic
1068486124 10:57661337-57661359 GGAGATCCTCACTGCCTCAAGGG + Intergenic
1070752533 10:78972704-78972726 TGGCAACCACACAGCCTCACAGG - Intergenic
1071248595 10:83791694-83791716 GGGCATCTTCACAGTCTCCAAGG - Intergenic
1071486034 10:86103385-86103407 GGGCCTCATCACAGGCTCACAGG - Intronic
1072609931 10:97011247-97011269 GGAGATCCCCACAGCCTCAATGG - Intronic
1073320616 10:102614098-102614120 GTGCATCCTCAGAGCCTTCAGGG + Intronic
1075064705 10:119281637-119281659 GGGCAACCTGCCAGCTTCAAAGG - Intronic
1076044289 10:127278644-127278666 GGCCAGCCTCACAGCCTGAGTGG - Intronic
1076508926 10:130998588-130998610 AGGAATCCTCACACCCTCAGTGG - Intergenic
1076731528 10:132441359-132441381 GGGCATCCCGACACCCCCAAAGG - Intergenic
1077672250 11:4167256-4167278 GGGCATGTTCACAGTCTCCAAGG + Intergenic
1077704060 11:4467331-4467353 GGGCCTCCCTACAGTCTCAAGGG - Intergenic
1080836585 11:35945340-35945362 GGGCATCCTCACAGCCCACTGGG + Intronic
1080924037 11:36737496-36737518 GGGCATCCTCAGAGCCTAGATGG + Intergenic
1084364431 11:68688298-68688320 GGGCAGCCTCCCAGCCTAGAAGG - Intronic
1085776522 11:79371518-79371540 AGGAATCCTCACAGCCCCCATGG + Intronic
1085885729 11:80519597-80519619 GGGCATCCTCACGGCTTGGATGG - Intergenic
1089378132 11:118009398-118009420 CTTCATCCTCACAGCCTCACAGG - Intergenic
1092100872 12:5882853-5882875 GGGGGTCCTCAGAGCCACAAAGG + Intronic
1094454363 12:30615922-30615944 GATCATCCTTACAGCCCCAAAGG - Intergenic
1094672221 12:32581329-32581351 GGGCTTCCTCACACACTCAAGGG - Intronic
1095385465 12:41644888-41644910 GGGCATCCTCTAAGCCTCTGAGG + Intergenic
1096961478 12:55582311-55582333 GGCCATCCTGGCAGCCACAAGGG - Intergenic
1097547595 12:61023665-61023687 GGGCATTCTGACAGCCCCGAGGG - Intergenic
1102031695 12:109743582-109743604 GGGCATCCTCATAGCCCCCCTGG - Intronic
1102255747 12:111414037-111414059 GGGCATCCTCCAAGCCACGAGGG + Intronic
1103037544 12:117668417-117668439 GGGGTGCCTCACAGCCTCACAGG + Intronic
1111611946 13:90616503-90616525 GGGCATCCCCCCATTCTCAATGG - Intergenic
1112494347 13:99893702-99893724 GGGCCTCCTCAAGGCCTCACTGG + Exonic
1113024577 13:105926545-105926567 TGGCACCCTCACTGCCTCAGGGG - Intergenic
1114083444 14:19220282-19220304 GCCCTGCCTCACAGCCTCAAAGG - Intergenic
1116321902 14:43478754-43478776 GGTCATCCTAACATCCTAAAAGG + Intergenic
1121793959 14:96720429-96720451 CGGCAGCCTCACAGCATCATGGG - Intergenic
1122323147 14:100867411-100867433 GGGCATGCTCACACACTCATAGG - Intergenic
1202895055 14_GL000194v1_random:2051-2073 GCCCTTCCTCATAGCCTCAAAGG - Intergenic
1127453133 15:59135743-59135765 GAGGATCCTGAAAGCCTCAAAGG + Exonic
1130922864 15:88363704-88363726 GGACATCCAGAGAGCCTCAAAGG - Intergenic
1131228870 15:90646287-90646309 GGGCATCTTCACAGGCTGATGGG - Intergenic
1132999272 16:2840986-2841008 GAGCCTCCTCACAGCCACCAAGG + Intergenic
1133360922 16:5173246-5173268 GGTCATCTCCACAGCCTGAAAGG + Intergenic
1133622231 16:7537376-7537398 GAGCATCATCACATCCTCAATGG - Intronic
1134626371 16:15725557-15725579 GGGTAGGCTAACAGCCTCAAAGG - Exonic
1135876190 16:26202415-26202437 GGGCATCCTAAGAGCATCACAGG + Intergenic
1138389046 16:56657309-56657331 GGGTCTCCCCACAGCCTCGACGG - Intronic
1139251486 16:65500662-65500684 GGGCCTCCTAACATCCACAATGG - Intergenic
1140146438 16:72315485-72315507 GGGACTCCTCACAGCCCAAAAGG - Intergenic
1141692349 16:85603376-85603398 GGTCATCCGCACAGCCCGAAAGG + Intergenic
1141936536 16:87242758-87242780 GGCAATGCTCACAGCCTCACAGG + Intronic
1143542974 17:7580507-7580529 GGGCACCCTCACAGCTTCCCTGG - Exonic
1147171229 17:38620212-38620234 GGGCAGCATCAGGGCCTCAAAGG - Intergenic
1148484147 17:47979819-47979841 GAGGCTCCTCCCAGCCTCAAGGG + Intronic
1150584460 17:66504951-66504973 GGGCTTCCTCAGAGGCTCATGGG - Intronic
1151719211 17:75846094-75846116 GGGCTTCCTCCCAGCCTCGGCGG + Exonic
1152347506 17:79762300-79762322 GGGCATCCTCGGAGCCTCTGGGG - Intergenic
1154500128 18:14991945-14991967 GCCCTGCCTCACAGCCTCAAAGG - Intergenic
1156334656 18:36158559-36158581 GGGCATCCTCTCATCCATAAAGG - Intronic
1160104675 18:75962041-75962063 GGGTATTTTCTCAGCCTCAAAGG - Intergenic
1160228817 18:77031304-77031326 GGGCATGCTCACAGCCTCGGGGG - Intronic
1160666925 19:335278-335300 GGGCAGCCACACAGCCTGTAGGG + Intronic
1160685148 19:431131-431153 GGACATCCTCACTGCCTCTCTGG + Intronic
1161468546 19:4445299-4445321 GCGCATCCCCACAGCCCCCAAGG + Exonic
1167274028 19:48524395-48524417 GGGCCTCCTCACAGACTCTTGGG - Intergenic
925975223 2:9137651-9137673 GTGCCTCCTGACAGCCTCACGGG + Intergenic
926019942 2:9485961-9485983 GGGAAGACTCACAGCCTCACCGG + Intronic
927459050 2:23281864-23281886 GGGCATCCTCACTATCTCAGGGG + Intergenic
930521598 2:52474399-52474421 GGACAGCCTCACAGCCTGCATGG + Intergenic
931335242 2:61335447-61335469 GGGCAACCACAAAGGCTCAATGG + Intronic
932086568 2:68767726-68767748 GGGTATCAGCACAGCCTCAGTGG + Intronic
933842946 2:86302238-86302260 GGCCAACCTCCCAGCCTCTAGGG + Intronic
934777124 2:96946666-96946688 GGGCATCCCCTCTGCCTCAGCGG + Intronic
934946668 2:98547415-98547437 GGGCATCCACCCAGCCCCCAGGG + Intronic
938493138 2:131776349-131776371 GCCCTGCCTCACAGCCTCAAAGG + Intergenic
938499342 2:131822304-131822326 GCCCTGCCTCACAGCCTCAAAGG - Intergenic
939700110 2:145380634-145380656 GGGAATCCTCAGAGCCTCTGTGG + Intergenic
941760845 2:169241257-169241279 GGGCATCCAGACTGCCTCTATGG - Exonic
944719230 2:202406289-202406311 GGGGTTGCTCACAGCCCCAAGGG - Intronic
945152198 2:206803243-206803265 GGGCATCCTCGCAGACTGCAAGG + Intergenic
948310222 2:236980030-236980052 GGCCTTCCTCACAGCCTCACTGG + Intergenic
948707602 2:239804773-239804795 AGGCATCCTCACTGTCTCAGAGG + Intergenic
1176710452 21:10145833-10145855 GCCCTGCCTCACAGCCTCAAAGG + Intergenic
1178875289 21:36409464-36409486 AGGTATCCTCAGAGCCTCAGGGG + Exonic
1180079102 21:45478162-45478184 GAGCCTCCTCACACCCACAAGGG - Intronic
1180183825 21:46129834-46129856 GGTCACCCTCACAGGCTCCAGGG + Intronic
1180294531 22:10872985-10873007 GCCCTGCCTCACAGCCTCAAAGG + Intergenic
1180497337 22:15902399-15902421 GCCCTGCCTCACAGCCTCAAAGG + Intergenic
1181268247 22:21643330-21643352 GGGAATCCACACAGCCTTGAGGG + Intronic
1181888674 22:26041930-26041952 GGGCTTCCTCTCAGTCTCACTGG + Intergenic
1183270253 22:36857644-36857666 GGGGATCCCCAGAGCCTGAATGG - Intergenic
1183675200 22:39295205-39295227 GACCATCCTCACAGCCTCAGGGG - Intergenic
1183741773 22:39672819-39672841 GGGCAGCCACACAGCCTAATGGG + Intronic
1183881724 22:40837732-40837754 AAGGATCCTCCCAGCCTCAAGGG + Intronic
1184010797 22:41746682-41746704 GGGACTCCTCACAGGCTCATAGG - Intronic
1185005190 22:48271721-48271743 TGGCAGCCTCTCAGCCTCCACGG - Intergenic
950484518 3:13265166-13265188 GGGCAACCTCACTGGCCCAAAGG + Intergenic
951102394 3:18703808-18703830 GGGGAACCTCACAGCCCTAAAGG + Intergenic
953194686 3:40721183-40721205 GGGCATCTGCGAAGCCTCAAGGG + Intergenic
953917953 3:46932654-46932676 GGGCCACATCACAGCCTCAGGGG + Intronic
956728505 3:72176544-72176566 GGTCAGCCTCACAGACACAAGGG - Intergenic
960991486 3:123314420-123314442 GCCCATCCTCACAGCTTCAGAGG + Intronic
961154222 3:124665321-124665343 AGACATCTTCACAGCTTCAAAGG - Intronic
961567894 3:127776535-127776557 GGGCATCCTCAATGCCTGGAGGG - Intronic
963227445 3:142876751-142876773 GGGCATCCTCACAGCATGGTGGG + Intronic
965339419 3:167468501-167468523 TGGCGTTCTCACAGCCTCACAGG + Intronic
966917046 3:184590812-184590834 GGGCATTAGCACAGCCTCATAGG + Intronic
969866546 4:10080183-10080205 GAACATCCTCTCAGCCTCAGGGG + Intronic
977211404 4:94222482-94222504 TGGCATCCTCACAGCCTGCTTGG - Intronic
979950105 4:126881645-126881667 GGTCATCATTACAGCCTCAGAGG - Intergenic
984626670 4:182015151-182015173 GGCCATCGTCACAGCCTGAGCGG + Intergenic
985920354 5:2966601-2966623 GGGCATCCCCAGAGCCTCTCAGG - Intergenic
990998434 5:61757271-61757293 AGGCAGCCGCACAGCCACAAGGG + Intergenic
993597690 5:89879998-89880020 GCACATTCTCACAGCTTCAAGGG - Intergenic
997469162 5:134107217-134107239 GGGACTGCTCACAGCCTCAGAGG + Intergenic
997472841 5:134126283-134126305 GGGGATGCCCACTGCCTCAAAGG - Intronic
998637190 5:143968884-143968906 GGGCATCTTTGCAGCCTGAAAGG - Intergenic
999131744 5:149288882-149288904 GGGAAGCCCCACATCCTCAATGG - Intronic
1000042789 5:157497708-157497730 TGGGATCCTCACAGCTTCCATGG + Intronic
1000594419 5:163197457-163197479 AGGGATCCTGTCAGCCTCAAGGG - Intergenic
1002200791 5:177526848-177526870 CTGCTGCCTCACAGCCTCAATGG - Intronic
1005197136 6:23300609-23300631 AGGCATGCCCACAGCCTCATAGG + Intergenic
1005946855 6:30601924-30601946 GAGCATCCTCACCTCCTCCATGG + Exonic
1007271576 6:40641374-40641396 GGGCATACCCACAGCCAGAAGGG - Intergenic
1008200329 6:48579811-48579833 GGACATCCTCACAGTCCCCAGGG - Intergenic
1012647113 6:101699547-101699569 GAGCATCCTCAGTCCCTCAAAGG + Intronic
1015252956 6:131146143-131146165 GGGCATTATCACTGCCCCAAAGG + Intronic
1016671790 6:146718086-146718108 GGGAAGCCTCACAGTGTCAAGGG - Intronic
1016790924 6:148065799-148065821 GGGCTTCCTCACAGCATGACAGG + Intergenic
1018428535 6:163704658-163704680 GGGCCTCCCCATAGCCTCTAAGG + Intergenic
1018800595 6:167219259-167219281 GTGAATCCTCCCAGCCTCCATGG + Intergenic
1019159818 6:170062447-170062469 GGGCATCTTGCCAGCCCCAAAGG + Intergenic
1023938162 7:44754395-44754417 GGACTTCCTCACACCCTCAGGGG - Intronic
1023987573 7:45105686-45105708 GGGCATCCCCAAGGCCTCCAAGG - Exonic
1033742368 7:144284801-144284823 GTGGATCCTCACATCCTCCATGG + Intergenic
1033751534 7:144364813-144364835 GTGGATCCTCACATCCTCCATGG - Exonic
1036482212 8:9149738-9149760 GGGCCTATTCACAGCCTTAAAGG + Intronic
1037798245 8:22014944-22014966 AGGCATACTCACATCATCAAGGG + Intergenic
1041249385 8:55919737-55919759 GGGCATCCAAAAAGCCACAACGG + Intronic
1042194932 8:66223772-66223794 GGGCTTACTCACAGCCTGGAAGG - Intergenic
1044830266 8:96240708-96240730 GGGCTTCCTCTGAGCCTCATCGG - Intronic
1048885916 8:138909739-138909761 GGGCATCTTCGCAACCACAATGG + Intronic
1050944054 9:11495600-11495622 GGGCATTCTCACTGGCTCACTGG - Intergenic
1053133661 9:35635630-35635652 CTGCATTCTCCCAGCCTCAAGGG + Intronic
1053647430 9:40131531-40131553 GCCCTGCCTCACAGCCTCAAAGG + Intergenic
1053758297 9:41332312-41332334 GCCCTGCCTCACAGCCTCAAAGG - Intergenic
1054328412 9:63729485-63729507 GCCCTGCCTCACAGCCTCAAAGG + Intergenic
1054537149 9:66244639-66244661 GCCCTGCCTCACAGCCTCAAAGG - Intergenic
1055771134 9:79718077-79718099 AGGCATCCTGACAGCCCCAAAGG - Intronic
1056789166 9:89614691-89614713 GGGCATCCACACAGCCTGGCAGG - Intergenic
1057553222 9:96067255-96067277 CGGCCTCCACACAGCCTCCAAGG + Intergenic
1057729802 9:97598471-97598493 GGCCATCCTCATTGCCTCATCGG - Intronic
1059517199 9:114907107-114907129 GGCCATCCTCATAGCTTCATGGG + Intronic
1061821520 9:133229517-133229539 GGACATCGACACAGCCTCAAGGG + Intergenic
1061833921 9:133316846-133316868 GGACATCAACACAGCCTCAAGGG - Intergenic
1062192353 9:135254535-135254557 GGGCATCCTCTCAGCCACCCTGG - Intergenic
1062237725 9:135520557-135520579 GGACATCAACACAGCCTCAAGGG - Intergenic
1202795216 9_KI270719v1_random:114828-114850 GCCCTGCCTCACAGCCTCAAAGG + Intergenic
1185673334 X:1828732-1828754 CGTCATCCTCATAGACTCAAAGG + Intergenic
1185673441 X:1829680-1829702 CGTCATCCTCATAGACTCAAAGG + Intergenic
1185772411 X:2774495-2774517 GGGCATCCTCACAGCCTCAAGGG + Intronic
1188516522 X:30993453-30993475 AGGCATCCTAAAGGCCTCAAGGG - Intergenic
1199078197 X:143547824-143547846 GGGCTGCCTCTCAGCCTAAATGG - Intergenic
1200229894 X:154438620-154438642 GGGCAGCCTCACCTCCTCCAGGG - Exonic
1201298325 Y:12484957-12484979 GGGCATCCTCATAGCCTCAAGGG - Intergenic