ID: 1185776835

View in Genome Browser
Species Human (GRCh38)
Location X:2809968-2809990
Sequence ATGCAGCTCCACCTCTGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 1, 2: 0, 3: 25, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185776832_1185776835 -3 Left 1185776832 X:2809948-2809970 CCTGGATTTTCAGAATGAAGATG 0: 1
1: 1
2: 0
3: 29
4: 253
Right 1185776835 X:2809968-2809990 ATGCAGCTCCACCTCTGGATGGG 0: 1
1: 1
2: 0
3: 25
4: 159
1185776829_1185776835 29 Left 1185776829 X:2809916-2809938 CCTTCACTTGTGTGACATTCTGT 0: 1
1: 0
2: 2
3: 29
4: 288
Right 1185776835 X:2809968-2809990 ATGCAGCTCCACCTCTGGATGGG 0: 1
1: 1
2: 0
3: 25
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185776835 Original CRISPR ATGCAGCTCCACCTCTGGAT GGG Intronic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
901822936 1:11841777-11841799 AAGCAGCCCCATCTCTGGAGTGG - Exonic
902046715 1:13530120-13530142 AGGCAGCTCCACCTTAGGAGTGG + Intergenic
903784949 1:25854282-25854304 ATGAAGCTCCACCTCTTGAAGGG + Intronic
904946760 1:34204938-34204960 ATGCATCTCCACCTCTAAAGGGG + Intronic
906801094 1:48737501-48737523 ATCCAGCTCCACCACTTCATAGG - Intronic
909790248 1:79668264-79668286 ATGCACACCCACCTCTGAATGGG + Intergenic
915710390 1:157892547-157892569 CTGCAGTTCCACTTCTGGTTTGG + Intronic
918198281 1:182243028-182243050 GTGCAGCTTCAACTCTGGCTAGG + Intergenic
919244672 1:194966181-194966203 AAGGAGATACACCTCTGGATTGG - Intergenic
919740707 1:200979770-200979792 GCGCAGCTCCACCTCTGCAGGGG + Intronic
919789426 1:201281014-201281036 AAGCAGATCCTTCTCTGGATAGG - Intergenic
920184182 1:204150422-204150444 TTGTACCTCCACCACTGGATGGG - Intronic
1062952677 10:1516362-1516384 ATCCAGCTGCACCTCGGGAAAGG - Intronic
1063078234 10:2738303-2738325 CTGCAGCTCCAGCTTTGGAGAGG - Intergenic
1064086879 10:12351627-12351649 GTGCAGCTGCACCTCTGCAGTGG + Intronic
1064283784 10:13974104-13974126 TGAAAGCTCCACCTCTGGATAGG + Intronic
1067703017 10:48587256-48587278 ATGCAGCCCCAACCCTGGAAAGG - Intronic
1067778026 10:49177005-49177027 CTGCACCTCCCCCTCTGGAAGGG - Intronic
1068814490 10:61294305-61294327 AAGCAGCTACAGCTCTGAATGGG + Intergenic
1070387882 10:75942281-75942303 AAACAGCTCAGCCTCTGGATGGG - Intronic
1070782174 10:79143986-79144008 ATGCCCCTCCAACTCTGCATCGG + Intronic
1071915283 10:90288571-90288593 ATATAGCTCCACCTCTTGATGGG - Intergenic
1074282948 10:112070214-112070236 TTGGGGCTCCACCTCTGGGTGGG - Intergenic
1074368338 10:112878206-112878228 ATGTGGCTCCACTTCTGGGTGGG - Intergenic
1076447170 10:130524630-130524652 ATGCAGACCCACCGCTGGAGTGG + Intergenic
1076717858 10:132375650-132375672 CTGCAGCACCACCTTTGGCTAGG + Exonic
1077231993 11:1461901-1461923 AAGCAGCTCCACCTCTGGGGGGG + Intronic
1078937021 11:15960962-15960984 AGCCAACTCCACCTCTTGATTGG - Intergenic
1080386314 11:31813047-31813069 ATGCGACCCCACCTCTGGCTAGG - Intronic
1084040029 11:66537278-66537300 CAGCAGCTACACCTCTGGGTGGG - Intronic
1086400390 11:86456698-86456720 ATTCAGCTGTACCTCTGGAAGGG + Intronic
1086649035 11:89264168-89264190 CTGCATTTCCACCTCTGGATTGG - Intronic
1087287783 11:96284282-96284304 ATGGACCTGCACCTCTGGAGAGG - Intronic
1088747514 11:112816865-112816887 ATGCAGTTCAACCTTTTGATAGG + Intergenic
1089897117 11:121941804-121941826 ATTAAGCTCCACCTCTGGAAAGG - Intergenic
1094065484 12:26357226-26357248 AGTCAGCCCCACCTCTGGAAAGG + Intronic
1096552835 12:52384838-52384860 ATGCAGCTCGTCCTCTGGCTTGG + Intronic
1097210947 12:57369192-57369214 ATGTAGCTCCACCTCTTAAAAGG + Intronic
1097661508 12:62435892-62435914 ATGCTGCTCGGCCTCTGGATGGG - Intergenic
1098429885 12:70407760-70407782 ATTCAGCACCACCTCAGGCTGGG - Intronic
1103444146 12:120983061-120983083 ATTCATCTCCACATCTGGAGGGG - Intronic
1103767765 12:123293901-123293923 CTGCACCTCCACCACTGGAGTGG + Exonic
1104918752 12:132279664-132279686 CTGCAGCTCCAGCTCTTGCTGGG + Intronic
1107410980 13:40158590-40158612 ATTCAACTCCACCTCTTGATGGG + Intergenic
1107412633 13:40172213-40172235 GCGCAGCTCCCCCTCTGGAGGGG - Intergenic
1107419746 13:40235142-40235164 CTGCAGTTCTACCTCTGGAATGG - Intergenic
1108581941 13:51835125-51835147 TAGCAGCTCCACATGTGGATAGG + Intergenic
1108912094 13:55567092-55567114 ATGCAGCTCCACCTAGGAATGGG - Intergenic
1112816731 13:103281619-103281641 AAGCAGTGCCATCTCTGGATGGG - Intergenic
1113219436 13:108082704-108082726 AAGTAGTTCCACCTCTGGAATGG - Intergenic
1113222106 13:108116788-108116810 CTGCAGCTCTACCTCTGGAGAGG - Intergenic
1116901033 14:50362301-50362323 AGGCAGCTCCACCTGTGGCCTGG + Intronic
1117400067 14:55351110-55351132 CTGCAGGCACACCTCTGGATTGG - Exonic
1117463652 14:55971399-55971421 CTGCAGCTCACCCTCTGGGTTGG - Intergenic
1122167301 14:99837588-99837610 TTGTAGCTCCACCTTTTGATAGG + Intronic
1122441440 14:101734778-101734800 ATGAAGTTCCACCCCTGGCTCGG - Intergenic
1124601475 15:31136175-31136197 TTGCAGCGCCTCCTCTGGATGGG + Intronic
1124890723 15:33729950-33729972 ATGCAGCTCCCACTCAGGTTGGG - Intronic
1124896072 15:33778616-33778638 ATGCAGCTTCACTTCTGGGCAGG - Intronic
1128277101 15:66362991-66363013 ATGCTGCTGCAGCTCTGAATGGG - Intronic
1128306252 15:66600778-66600800 ATGCACCTGCACCTCCTGATGGG + Intronic
1131993523 15:98112919-98112941 CTGCAGCAACACTTCTGGATGGG + Intergenic
1132376041 15:101328759-101328781 AGGCATCTCCACCCTTGGATGGG - Intronic
1132764067 16:1525562-1525584 GAGCAGCTCCTCCTCTGGAGAGG + Intronic
1134188080 16:12099858-12099880 ATGCAAATCCATCTCTGGAGTGG + Intronic
1135576536 16:23590239-23590261 ATGCAGCACCCACTCTAGATTGG - Intronic
1136008423 16:27346843-27346865 ATGCCGCTCCTCCTCTGTAAAGG + Intronic
1136066078 16:27759797-27759819 AGGAAACTCCAACTCTGGATGGG + Intronic
1139466965 16:67159345-67159367 GGGCAGCCCCACCTCTGGCTGGG + Intronic
1139822089 16:69728736-69728758 TTTGAGCCCCACCTCTGGATGGG - Intergenic
1142128986 16:88423942-88423964 ATGAGGCTCCACCTCTTGAAGGG + Intergenic
1144456818 17:15425673-15425695 ATTAAGCTCCACCTCTGGAAGGG + Intergenic
1144817095 17:18041973-18041995 ATGCTGCCCTACATCTGGATTGG + Intronic
1144874250 17:18388932-18388954 CTGCAGCACTGCCTCTGGATGGG - Exonic
1145157978 17:20555486-20555508 CTGCAGCACTGCCTCTGGATGGG + Intergenic
1150687839 17:67334978-67335000 AAGCAGCCCCACCTGTGGTTTGG + Intergenic
1153887779 18:9482468-9482490 TTGCAGCCCCACCCCTGGATGGG + Intronic
1157468384 18:47968123-47968145 TATCAGCTCCACCTCTGGAGGGG - Intergenic
1159704288 18:71667331-71667353 ATCCAGCTCAACCACTGGCTAGG + Intergenic
1160889813 19:1371295-1371317 AAGCAGCTCCATCTCTGCACAGG - Intronic
1160952367 19:1673914-1673936 ATCCAGCCCCACCACTGGAGAGG - Intergenic
1162244164 19:9385387-9385409 ATACAGCTCCACTTCCAGATTGG + Intergenic
1162823617 19:13237791-13237813 ACCCAGCTCCACCTGGGGATGGG + Intronic
1167144724 19:47674935-47674957 ATTGAGCTCCACCTCTTGAAAGG + Intronic
925245272 2:2377155-2377177 AGCCAGCTCCACCTGTGGACAGG + Intergenic
926558749 2:14392070-14392092 ATGCTACTCCACCCCAGGATGGG - Intergenic
927047149 2:19290795-19290817 ATCCAGGTCTACCTCTGGGTAGG - Intergenic
927373858 2:22390161-22390183 ATGAAGAAACACCTCTGGATTGG + Intergenic
927475039 2:23407259-23407281 ATGCTGCTCCACCTCTGACTTGG - Intronic
927489064 2:23508570-23508592 ATTAGGCTCCACCTCTTGATGGG + Intronic
929039622 2:37731312-37731334 ATGCAGCTGGACCTCGGGAGAGG + Intronic
929070129 2:38020915-38020937 AGGCAGCTCCACCTGTGGCCGGG + Intronic
932097310 2:68862890-68862912 ATGCAGGTTTACATCTGGATGGG + Intergenic
932734825 2:74247266-74247288 ATGGAGTTCCGCCTCTGGATTGG - Exonic
935851881 2:107230641-107230663 ATGCCGCTCCAGCTCTGGGTAGG + Intergenic
937268442 2:120631949-120631971 ATCCAGCACCACATCTGGCTGGG + Intergenic
939550406 2:143608122-143608144 ATGATGCTTGACCTCTGGATGGG + Intronic
940058126 2:149534986-149535008 ATGCACCTGCACCTGTGGCTAGG + Intergenic
942299533 2:174548546-174548568 AGGCAGCTCCACCTGTGGCCTGG - Intergenic
943858354 2:192828149-192828171 AAGCACCTCCACATCTGGTTGGG - Intergenic
944460252 2:199941802-199941824 CTTCAGGTCCACCTCAGGATTGG + Intronic
1169122400 20:3105058-3105080 CTGCAGCGCCACCTGTGGAAAGG + Intergenic
1170905978 20:20515588-20515610 AAGCAGTTCCAGCTCTGGGTAGG - Intronic
1172302793 20:33861912-33861934 ATTAGGCTCCACCTCTTGATGGG + Intergenic
1176520060 21:7817712-7817734 GAGCAGCTCCATCTCTGGGTGGG + Exonic
1177715056 21:24829329-24829351 ATGAAGCTCCACCTTTTTATAGG + Intergenic
1178228110 21:30748126-30748148 ATGAAGCTCCACCTCAGTTTTGG - Intergenic
1178654087 21:34447724-34447746 GAGCAGCTCCATCTCTGGGTGGG + Intergenic
1179882094 21:44297144-44297166 ATGGAGCTGCCCCTCTGGATGGG + Intronic
1185153584 22:49180098-49180120 AAGCAGATCCACCTCTGGAATGG + Intergenic
1203291902 22_KI270736v1_random:2890-2912 ATGCAGCTGGACCTCAGGAGAGG + Intergenic
950481223 3:13245424-13245446 AAAGGGCTCCACCTCTGGATGGG + Intergenic
950653538 3:14422653-14422675 ATGCAACTCTACCTCTGGCTGGG - Intronic
951528546 3:23677607-23677629 ATGTAACTGCTCCTCTGGATTGG + Intergenic
955802455 3:62700230-62700252 ATTAAGCTCCACCTCTTGAAGGG - Intronic
961826079 3:129599776-129599798 CTGCAGTTCCCCCTCTGGCTGGG - Intronic
962167436 3:133063824-133063846 AGGCAGCCCCTCCTCTGGCTGGG - Intronic
963437454 3:145289338-145289360 ATGCTGCTTCAACTCTGGTTGGG + Intergenic
963729521 3:148957841-148957863 CAGCAGCTCCCCCTATGGATGGG - Intergenic
965951952 3:174319715-174319737 AATCAGTTCCACCTCTGGGTAGG - Intergenic
966757851 3:183388303-183388325 ATGCAGCTCAAGGTCTGGAATGG - Intronic
967540741 3:190664790-190664812 ATTCAGCTCCACCTCTTGGATGG + Intergenic
968609723 4:1551444-1551466 ATGCAGCTCCACCTCCTGCCAGG - Intergenic
968617865 4:1588334-1588356 ATTAAGCTCCACCTCTTGAAGGG - Intergenic
969281296 4:6172442-6172464 ATGCTGCTCCAGCTCTGGCCTGG + Intronic
969322966 4:6424158-6424180 CTGGAGCTCCAGCTCTGGAGAGG + Intronic
969493837 4:7514810-7514832 ATACAGCCTCACCTCTGGAGGGG - Intronic
970827279 4:20290999-20291021 ATGCTGGGCCACCCCTGGATTGG - Intronic
976358065 4:84144091-84144113 ATGAAGCTCCACCTCCTGAAAGG - Intergenic
977189510 4:93981964-93981986 ATTCTTCTCCTCCTCTGGATAGG - Intergenic
985741847 5:1622206-1622228 ATGCAGCTGCAGACCTGGATAGG - Intergenic
985877981 5:2614714-2614736 ATGCAGCTCCACAAGTGGACAGG + Intergenic
990895673 5:60698292-60698314 ATTCAACTCCACTTCTTGATGGG - Intronic
993077021 5:83245060-83245082 ATGCTGCTCCTTCTCAGGATGGG - Intronic
993950879 5:94173690-94173712 ACGAGGCTCCACCTCTTGATGGG + Intronic
995372389 5:111433590-111433612 ATTAGACTCCACCTCTGGATGGG + Intronic
1001069338 5:168570633-168570655 ATGCCTCTTCACCTTTGGATGGG - Intronic
1005059362 6:21761569-21761591 AGGCAGCTCCACCTGTGGCCCGG + Intergenic
1005847976 6:29797184-29797206 ATGAAGCTGCACTTCTGGAAAGG - Intergenic
1005863707 6:29922350-29922372 ATTCAGCTGCACCTCTGGAAGGG - Intergenic
1006624420 6:35387141-35387163 ATGCAACTCCACCTTTTGCTTGG - Intronic
1008801370 6:55372536-55372558 ATGCAGCTCTACCTCAGCATAGG + Intronic
1011212644 6:84970543-84970565 ATGCGACTACACCTCTTGATGGG + Intergenic
1013067296 6:106696138-106696160 ATACAGAACCACCTTTGGATAGG - Intergenic
1014134798 6:117876273-117876295 ATTAAGCTCCACCTCTGGAGGGG + Intergenic
1016196857 6:141354393-141354415 ATCTAGCTCCACCTATGGCTTGG + Intergenic
1016691945 6:146948218-146948240 AAGCACCTCCACTTCTGAATGGG - Intergenic
1017866924 6:158452009-158452031 ATGCAGATCCTACTCTGGATTGG - Intronic
1019797976 7:3066017-3066039 ATGTATTTCCACCTCTGCATGGG - Intergenic
1021993806 7:26160847-26160869 ATCCAGCTCCACCTCTTCCTGGG + Intronic
1024112243 7:46159158-46159180 AAGCACCTCCACCTCTATATTGG - Intergenic
1024167119 7:46746346-46746368 ATGCAGCTTTGCCCCTGGATGGG - Intronic
1024347039 7:48323683-48323705 TTCCAGCTCCACCACTTGATAGG - Intronic
1026450308 7:70523532-70523554 CTGCAGCTCCACCTAGGGAGAGG - Intronic
1027493553 7:78860278-78860300 ATGCAGCTCCTCCTCAGCAATGG - Intronic
1028169935 7:87584032-87584054 ATGCTGCACCACCTCTGAACTGG - Intronic
1034562104 7:151887054-151887076 AGGCAGTGCCACCTGTGGATGGG + Intergenic
1035733986 8:1874415-1874437 ATGCAGCTCCAGCTCTCAAAGGG + Intronic
1036176126 8:6540059-6540081 ATGCCTCTCCTCCTGTGGATAGG + Intronic
1040610865 8:48980796-48980818 ATGTAGTTCCTCCTCTGGCTTGG + Intergenic
1041578298 8:59425528-59425550 ATGCAGCTCCACCAATCCATTGG + Intergenic
1045317221 8:101053554-101053576 ATTCAGCTCCATCTCTTGAAGGG - Intergenic
1047361804 8:124175879-124175901 ATGCACCACCACATCTGGCTGGG + Intergenic
1049744847 8:144258933-144258955 CTGCAGCTCCAGCACTGGCTGGG + Intronic
1056499185 9:87190922-87190944 AGGAAGCCCCACCTCTGTATGGG - Intergenic
1057113389 9:92497025-92497047 ATGGTGCGCCACCTCTGGAGAGG + Intronic
1059409923 9:114125355-114125377 TTCCAGCTTCACCTCTGCATTGG + Intergenic
1061395716 9:130342426-130342448 ACGCAGCTTCACCTCTGGCAGGG - Intronic
1061397196 9:130349588-130349610 CTGCAGCTCCACGTCTGCACCGG - Intronic
1062152785 9:135030467-135030489 AAGCAGCGCCACCTCTGCAGCGG + Intergenic
1185572436 X:1145332-1145354 ATTCACCTTCACCTCTGGAAGGG - Intergenic
1185776835 X:2809968-2809990 ATGCAGCTCCACCTCTGGATGGG + Intronic
1187950355 X:24465034-24465056 TTTCAGCTCCGCCTCTGGCTGGG - Intergenic
1189255486 X:39635320-39635342 AAGCATTTCCACCTCTTGATGGG + Intergenic
1190204091 X:48388188-48388210 CTGCAGATCCAACTCTGGTTTGG + Intronic
1190206445 X:48407215-48407237 CTGCAGATCCAACTCTGGTTTGG - Intronic
1192035882 X:67562523-67562545 AAGCAGCTGATCCTCTGGATGGG + Intronic
1192166809 X:68831690-68831712 ATGCAGCTCCACAGCTGGAAAGG + Intronic
1196747550 X:119085278-119085300 ATGCAGCTCCCCCTCTCTTTGGG - Intronic
1197854751 X:130902921-130902943 ACCCAGCTCCACCTCTGCAGGGG - Intronic
1198593824 X:138214491-138214513 ATTCTGCACCACCTCTGCATAGG - Intergenic
1198595320 X:138229721-138229743 ATGCTGCTGCACCTCTGAATGGG - Intergenic
1199285033 X:146046140-146046162 AGGCAGCTCCACCTGTGGCCCGG - Intergenic
1200046453 X:153405353-153405375 ATCCAGCTACACCTCTTGAAAGG - Intergenic
1201293159 Y:12441498-12441520 ATGCAGCTCCACCTCTGGACGGG - Intergenic