ID: 1185777799

View in Genome Browser
Species Human (GRCh38)
Location X:2819517-2819539
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185777799_1185777804 19 Left 1185777799 X:2819517-2819539 CCTACCATGTGCCCGTCAGGGAC No data
Right 1185777804 X:2819559-2819581 CAGTAACTGCAGAATTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185777799 Original CRISPR GTCCCTGACGGGCACATGGT AGG (reversed) Intergenic
No off target data available for this crispr