ID: 1185777801

View in Genome Browser
Species Human (GRCh38)
Location X:2819521-2819543
Sequence ACCAGTCCCTGACGGGCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185777801_1185777804 15 Left 1185777801 X:2819521-2819543 CCATGTGCCCGTCAGGGACTGGT No data
Right 1185777804 X:2819559-2819581 CAGTAACTGCAGAATTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185777801 Original CRISPR ACCAGTCCCTGACGGGCACA TGG (reversed) Intergenic
No off target data available for this crispr