ID: 1185777803

View in Genome Browser
Species Human (GRCh38)
Location X:2819529-2819551
Sequence TTTTAAGTACCAGTCCCTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185777803_1185777804 7 Left 1185777803 X:2819529-2819551 CCGTCAGGGACTGGTACTTAAAA No data
Right 1185777804 X:2819559-2819581 CAGTAACTGCAGAATTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185777803 Original CRISPR TTTTAAGTACCAGTCCCTGA CGG (reversed) Intergenic
No off target data available for this crispr