ID: 1185777804

View in Genome Browser
Species Human (GRCh38)
Location X:2819559-2819581
Sequence CAGTAACTGCAGAATTTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185777803_1185777804 7 Left 1185777803 X:2819529-2819551 CCGTCAGGGACTGGTACTTAAAA No data
Right 1185777804 X:2819559-2819581 CAGTAACTGCAGAATTTGAGAGG No data
1185777798_1185777804 20 Left 1185777798 X:2819516-2819538 CCCTACCATGTGCCCGTCAGGGA No data
Right 1185777804 X:2819559-2819581 CAGTAACTGCAGAATTTGAGAGG No data
1185777802_1185777804 8 Left 1185777802 X:2819528-2819550 CCCGTCAGGGACTGGTACTTAAA No data
Right 1185777804 X:2819559-2819581 CAGTAACTGCAGAATTTGAGAGG No data
1185777801_1185777804 15 Left 1185777801 X:2819521-2819543 CCATGTGCCCGTCAGGGACTGGT No data
Right 1185777804 X:2819559-2819581 CAGTAACTGCAGAATTTGAGAGG No data
1185777799_1185777804 19 Left 1185777799 X:2819517-2819539 CCTACCATGTGCCCGTCAGGGAC No data
Right 1185777804 X:2819559-2819581 CAGTAACTGCAGAATTTGAGAGG No data
1185777796_1185777804 21 Left 1185777796 X:2819515-2819537 CCCCTACCATGTGCCCGTCAGGG No data
Right 1185777804 X:2819559-2819581 CAGTAACTGCAGAATTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185777804 Original CRISPR CAGTAACTGCAGAATTTGAG AGG Intergenic
No off target data available for this crispr