ID: 1185778768

View in Genome Browser
Species Human (GRCh38)
Location X:2828723-2828745
Sequence GGCCGCGGCGGGCGAGGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1467
Summary {0: 1, 1: 1, 2: 27, 3: 168, 4: 1270}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185778754_1185778768 2 Left 1185778754 X:2828698-2828720 CCTAGAAACCGCCGACTGCCGAA 0: 1
1: 0
2: 0
3: 2
4: 11
Right 1185778768 X:2828723-2828745 GGCCGCGGCGGGCGAGGGGCGGG 0: 1
1: 1
2: 27
3: 168
4: 1270
1185778758_1185778768 -6 Left 1185778758 X:2828706-2828728 CCGCCGACTGCCGAAGGGGCCGC 0: 1
1: 0
2: 1
3: 4
4: 60
Right 1185778768 X:2828723-2828745 GGCCGCGGCGGGCGAGGGGCGGG 0: 1
1: 1
2: 27
3: 168
4: 1270
1185778753_1185778768 7 Left 1185778753 X:2828693-2828715 CCAAACCTAGAAACCGCCGACTG 0: 1
1: 1
2: 0
3: 0
4: 27
Right 1185778768 X:2828723-2828745 GGCCGCGGCGGGCGAGGGGCGGG 0: 1
1: 1
2: 27
3: 168
4: 1270
1185778760_1185778768 -9 Left 1185778760 X:2828709-2828731 CCGACTGCCGAAGGGGCCGCGGC 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1185778768 X:2828723-2828745 GGCCGCGGCGGGCGAGGGGCGGG 0: 1
1: 1
2: 27
3: 168
4: 1270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185778768 Original CRISPR GGCCGCGGCGGGCGAGGGGC GGG Intergenic
900144043 1:1150374-1150396 GGCCCCACCCGGCGAGGGGCAGG + Intergenic
900158809 1:1213872-1213894 GGAGGGGGCGGGTGAGGGGCCGG - Intronic
900203153 1:1420231-1420253 GGCGGCCGCGGGCGGGCGGCTGG - Exonic
900237409 1:1599352-1599374 GGCCGGGGCGCGCGAGGGCCGGG + Exonic
900244273 1:1630318-1630340 TGGCGCGGCGGGCCGGGGGCGGG - Exonic
900300503 1:1974478-1974500 GGCTGCGGTGGGCCTGGGGCAGG + Intronic
900307728 1:2019278-2019300 GGCTGGGGCGGGCTCGGGGCGGG + Intergenic
900307755 1:2019401-2019423 GGCCGCGGCGGGCTCGGGACGGG - Exonic
900349672 1:2228503-2228525 GGCGGCGGCGGGCGCGGCGCGGG + Intergenic
900370967 1:2331983-2332005 CGCAGCGGCGGGAGAGGCGCAGG - Intronic
900393424 1:2443566-2443588 GGCTGCGGCGGGCGCAGGGCGGG + Intronic
900431231 1:2604117-2604139 GGCCGGGGCGGGTGGGGAGCGGG - Intronic
900467016 1:2830851-2830873 GGCGGGGGCGGGGGCGGGGCAGG - Intergenic
900483701 1:2911392-2911414 CGCCGCGGCGGCCGCGGTGCAGG - Intergenic
900645254 1:3706113-3706135 GGCGGAGGCGGGCCGGGGGCGGG - Intronic
901066569 1:6497283-6497305 GGACCCGGCGGACGCGGGGCGGG - Intronic
901084607 1:6602908-6602930 CGCCGCGGCTCTCGAGGGGCGGG + Intronic
901086100 1:6613413-6613435 GGTCTCGGCGGGCGCGGGGGCGG - Intronic
901109852 1:6785677-6785699 GGGCGCGGCGGGCGGGCGGGCGG + Intronic
901242865 1:7704953-7704975 GGCGGGGGCGCGCGCGGGGCGGG + Intronic
901332770 1:8423735-8423757 GGGCCCGGGGGGCGCGGGGCTGG + Intronic
901433875 1:9234712-9234734 GGCGGGGGCGGGGGCGGGGCGGG - Intergenic
901433996 1:9235081-9235103 GGCCGGGGCGGCGGCGGGGCCGG - Intronic
901438087 1:9261728-9261750 GGCAGGGCGGGGCGAGGGGCTGG + Intronic
901628951 1:10638954-10638976 GGCTGCAGTGGGCGCGGGGCCGG + Exonic
901641448 1:10694968-10694990 GGCCGCGCGGGTCGTGGGGCAGG - Intronic
901673102 1:10867301-10867323 GGCCGCGGGCGGCGCGGGGACGG + Intergenic
901676577 1:10889021-10889043 GGCCGGGGCGGGCGGGCTGCGGG + Intergenic
902214121 1:14924039-14924061 CGCCGCGGCGGGGCGGGGGCGGG + Intronic
902385591 1:16073684-16073706 GGGCGCGGCGGGCGGGGCCCGGG + Intergenic
902451504 1:16499356-16499378 GGCCGAGGCGGGGGCGGGGGCGG + Intergenic
902451508 1:16499362-16499384 GGCGGGGGCGGGGGCGGGGCCGG + Intergenic
902470369 1:16644646-16644668 GGTCGCGGCGGCCGAGGCTCGGG - Intergenic
902770086 1:18640827-18640849 GGGCGCGCCGGGCCGGGGGCTGG + Intronic
902823232 1:18956220-18956242 GGCGGCGGCGGGGCAGGGCCGGG - Exonic
902823235 1:18956226-18956248 GGCGGCGGCGGCGGCGGGGCAGG - Exonic
903153316 1:21428306-21428328 GGCGGCGGCGCGCCAGCGGCAGG + Intergenic
903251101 1:22053294-22053316 GGCCGCGGCGGGGCGGTGGCAGG + Intronic
903350051 1:22711605-22711627 GTACGCCGCGGGCGATGGGCAGG - Intronic
903501021 1:23800285-23800307 GTCCGCGCCAGGCGCGGGGCGGG - Intronic
903542535 1:24105088-24105110 GGCCTCGCCTGGGGAGGGGCGGG - Intronic
903788322 1:25875649-25875671 GTGCGCGGCGGGCGGGGTGCGGG - Intergenic
903813057 1:26045621-26045643 GCCCGCGGGGGGCCTGGGGCCGG - Intronic
903907292 1:26696171-26696193 GGCGGCGGCGGCCGAGGCGCCGG - Exonic
903907562 1:26697065-26697087 GGCCGGGGCGGGCGGGGGGTAGG - Exonic
903950674 1:26994302-26994324 GGCCGCGGCGGCCGCGGCGCGGG - Exonic
904003147 1:27349830-27349852 TCCCGCGGCGAGGGAGGGGCAGG - Intronic
904213128 1:28898730-28898752 GGCCAAGGCGGGCAAGGGGCAGG - Intronic
904237363 1:29123932-29123954 GGCCGGGGCGGGGCTGGGGCCGG - Intronic
904237671 1:29124893-29124915 GGAAGGGGCGGGCCAGGGGCCGG + Intergenic
904498790 1:30902372-30902394 GGCCATGGCGGGAGGGGGGCCGG + Intronic
904563337 1:31413161-31413183 GGCCGGGGCGGGGCCGGGGCCGG + Intronic
904751077 1:32741797-32741819 GGGAGCGGCGCGGGAGGGGCCGG - Intergenic
904753281 1:32754186-32754208 GGCCGGGGTGGGGGCGGGGCAGG + Intronic
904784164 1:32973128-32973150 GGATGCGGCACGCGAGGGGCGGG - Intergenic
905369287 1:37474654-37474676 GGCCTCGGCGGGGAAGCGGCAGG + Intronic
905617107 1:39408923-39408945 GGGCCCGGCGGGGGCGGGGCCGG - Intronic
905639149 1:39576591-39576613 TGCGGCGGCGGGCGCGGGGCAGG + Intronic
905648271 1:39639687-39639709 GGCCGGGGCGGGGCCGGGGCGGG - Exonic
905773627 1:40654152-40654174 GGGCGGGGAGGGGGAGGGGCGGG - Intronic
906128505 1:43442141-43442163 GGCCCGGGGGGGCGGGGGGCGGG + Intronic
906319166 1:44806071-44806093 GGACGTGGCGCGCGATGGGCTGG - Exonic
906488155 1:46247478-46247500 GGGGGTGGCGGGGGAGGGGCGGG - Intergenic
906532825 1:46533221-46533243 GGCCGCGGCGGGCCCGGGCCAGG - Intergenic
906615842 1:47232259-47232281 GGGCCGGGCGGGCGCGGGGCGGG - Intergenic
907069306 1:51519364-51519386 GGGCGGGGCGGGCGTGGGGAGGG - Intergenic
907277665 1:53326273-53326295 GGCCGGGGCGGGGCCGGGGCAGG + Intronic
907341576 1:53739263-53739285 GGCCGCGGCCAGCCAGTGGCTGG - Intergenic
907430237 1:54406948-54406970 GGGCGGGGCGGGCTGGGGGCCGG - Intronic
907689149 1:56645259-56645281 AGCCGCGAGGGGCGCGGGGCGGG - Intronic
907689162 1:56645288-56645310 GGGCCCTGCGGGCGAGGGGGCGG - Intronic
908272849 1:62437297-62437319 GGACCCGGCGGGCTCGGGGCAGG + Exonic
908555650 1:65254505-65254527 GACCGCGGCGGGGGAGGGCGCGG + Intronic
910277458 1:85464683-85464705 GCCGGCGGCGGGGGAGGGCCTGG + Intronic
910449533 1:87331564-87331586 GGCGGGGGCTGGGGAGGGGCCGG + Intronic
910788033 1:91021771-91021793 GGCGGCGGCGGCCGAGGAGGCGG - Intronic
911078991 1:93909505-93909527 TCCCGCGGCGGGGCAGGGGCGGG + Intergenic
911114941 1:94237364-94237386 GGCCGCGGCGGTCGTGGCTCCGG - Intronic
911208676 1:95117726-95117748 GGCCGCGCTAGGCCAGGGGCGGG - Intronic
911348133 1:96721670-96721692 GGCAGCGGGAGGCGAGCGGCAGG - Intronic
911498800 1:98661603-98661625 CTGCGCAGCGGGCGAGGGGCTGG + Intergenic
911618363 1:100038635-100038657 GGGCGCGGCGGGCGGGCCGCCGG - Intronic
912354336 1:109042332-109042354 GGGCGGGGCGGGCGGGGGTCGGG + Intergenic
912422033 1:109548948-109548970 GGGCGTGCCGGGCGTGGGGCGGG + Intronic
912492715 1:110070734-110070756 CGCCGCGGGGGGCGGGGGGCGGG + Intronic
912492720 1:110070741-110070763 GGGGGCGGGGGGCGGGGGGCAGG + Intronic
913129736 1:115828714-115828736 GGCGGCGGCGGGCTGGGGGCGGG + Intergenic
913131092 1:115838881-115838903 AGCCGCGGCGCCCGAGGGCCTGG + Exonic
913248538 1:116891891-116891913 GGCCAAGGCTGGGGAGGGGCTGG + Intergenic
913565631 1:120069704-120069726 GGCCGCGGCGACAGTGGGGCGGG - Intergenic
913632498 1:120723849-120723871 GGCCGCGGCGACAGTGGGGCGGG + Intergenic
913979475 1:143497119-143497141 AGCCGCGGCGGCGGGGGGGCGGG - Intergenic
914286227 1:146229078-146229100 GGCCGCGGCGACAGTGGGGCGGG - Intergenic
914547255 1:148679820-148679842 GGCCGCGGCGACAGTGGGGCGGG - Intergenic
914619248 1:149390523-149390545 GGCCGCGGCGACAGTGGGGCGGG + Intergenic
914694710 1:150067024-150067046 CGCCGAGGCGGGGGCGGGGCAGG + Intergenic
914702919 1:150150301-150150323 GGCGGCGGCGGCCGCAGGGCGGG - Intronic
914758458 1:150579764-150579786 GGCCGGGGCGGGGCCGGGGCCGG + Intergenic
914817084 1:151071075-151071097 GGCAGCGGCGGGAGGGGGACGGG + Intronic
914845901 1:151283271-151283293 CGCAGAGGAGGGCGAGGGGCTGG - Intronic
914942638 1:152036572-152036594 GGAGACCGCGGGCGAGGGGCTGG + Intronic
915213298 1:154325493-154325515 GGCGGCGGGGGCCGGGGGGCGGG - Intergenic
915225030 1:154405668-154405690 GGCCGCGCCGGGAGCGGCGCTGG + Exonic
915722169 1:157993554-157993576 GGCGCGGGCGGGCGGGGGGCGGG + Intronic
915937768 1:160098942-160098964 GGGCGGGGCGGGGGAGGGGCCGG - Intronic
916890257 1:169106614-169106636 GGCGGCGGCGGCGGCGGGGCGGG - Exonic
917869614 1:179229712-179229734 GGGGGCGGGGGGCGGGGGGCGGG - Intergenic
917904579 1:179575987-179576009 GGGGGCTGAGGGCGAGGGGCGGG + Intergenic
918093661 1:181317613-181317635 GGGGGCGGCGGGCGGGGGGAGGG - Intergenic
919809397 1:201399330-201399352 GGCGGCGGCCGGCGGGGCGCGGG - Exonic
919809474 1:201399573-201399595 GCCCGGGGCCGGCGTGGGGCTGG + Exonic
920002334 1:202808259-202808281 GGCAGCGCCGGGCGCGGGCCTGG + Exonic
920184586 1:204152076-204152098 GGCCGGGGCGGGGGCGGGCCGGG - Intergenic
920609692 1:207424495-207424517 TGCTGGGGCGGGCGGGGGGCGGG + Intergenic
921060445 1:211579662-211579684 CTCGGCGGCGGGGGAGGGGCCGG + Intergenic
921138616 1:212285271-212285293 TGCGGCGGCGGGGGAGGGGGCGG - Intergenic
921189822 1:212699602-212699624 CGCCGCGGGGGGCGAGGAGGTGG - Intronic
921206774 1:212856232-212856254 GGCCGGGGCGGGCGGAGGGGGGG + Intergenic
921355565 1:214281444-214281466 GGCGGCGGCGGGCGGGAGCCGGG + Intronic
921472669 1:215567561-215567583 GGCGGCGGCGGCCGGAGGGCGGG - Exonic
921599286 1:217089722-217089744 TGCCCCCGCGGGCGCGGGGCCGG + Intronic
922134869 1:222814976-222814998 GCCGGGAGCGGGCGAGGGGCGGG + Intergenic
922502931 1:226110222-226110244 GGCCGCGGCGGAGGCCGGGCTGG + Intergenic
922602871 1:226870552-226870574 GGCCTGGGCGGGCGTGGGGCGGG + Exonic
922696960 1:227735635-227735657 GGCTGCGCTGGGAGAGGGGCGGG + Intronic
922746282 1:228045945-228045967 AGCCGCGGCTGCCTAGGGGCAGG - Intronic
922803757 1:228375512-228375534 GGCCTCTCCTGGCGAGGGGCTGG - Intronic
922894190 1:229088073-229088095 GACCCCGGCGTGGGAGGGGCTGG - Intergenic
923141061 1:231162091-231162113 GGCAGCGGCGGGAGGGAGGCGGG + Intronic
923490259 1:234478337-234478359 GCCCGCGGCGCGCGCGAGGCGGG - Exonic
923498411 1:234544497-234544519 GGCGGTGGAGGGAGAGGGGCTGG + Intergenic
924198953 1:241640182-241640204 GGCCGCGGGCGCTGAGGGGCCGG - Exonic
924289598 1:242524337-242524359 GGGCGCGGAGGGCGAGCGGGAGG + Exonic
924436567 1:244048625-244048647 GGCGGGGGCGGGGGGGGGGCGGG - Intergenic
924524577 1:244835204-244835226 GGCTGGGGCGGGCTGGGGGCTGG + Intergenic
924638236 1:245808988-245809010 GGCCGAGGCGGGCGGAGGTCAGG - Intronic
924775196 1:247111434-247111456 GGCCCGGGCGGGCGCAGGGCCGG + Exonic
1062774717 10:135528-135550 GGCGGCGGCGGTGGAGGAGCCGG + Intronic
1063418128 10:5889940-5889962 AGCAGCGGCGGTCGAGGGGCGGG - Intergenic
1063473697 10:6309620-6309642 GGCCGGCGGGGGTGAGGGGCGGG - Intergenic
1063663654 10:8049722-8049744 GGCCGAGGCGGAGGAGGGGGCGG + Intergenic
1064167873 10:13001801-13001823 GGCGTGGGCGGGGGAGGGGCGGG + Intronic
1064179234 10:13100322-13100344 TGCAGCGGTGGGCGAGGGGGCGG + Intronic
1064274191 10:13891761-13891783 GGCGGCGGCGGGGACGGGGCGGG - Intronic
1064274230 10:13891871-13891893 GCCGGGCGCGGGCGAGGGGCGGG - Intronic
1064418272 10:15168801-15168823 GGGCGCGGACGGTGAGGGGCGGG - Intergenic
1064619586 10:17201636-17201658 GGCTGCGGCGGCTGAGGCGCGGG - Exonic
1064981991 10:21174254-21174276 GGGCGCAGCGGGGGAGGGGGCGG + Intergenic
1065024519 10:21527266-21527288 GGCCTCGGGGGGCGGGGGCCGGG + Intergenic
1065099759 10:22321378-22321400 GGCGGCGGCGGCCGAGGAGGAGG + Exonic
1065099883 10:22321837-22321859 GGCGGCGCGGGGCGCGGGGCCGG - Intronic
1065342897 10:24723403-24723425 GCCCGCGGCGGGCGCCCGGCGGG - Intronic
1065726073 10:28668872-28668894 GGACTCGGCCGGGGAGGGGCGGG + Intergenic
1066464399 10:35640328-35640350 GGGCGCGGCGGGCGCGGGCGCGG - Exonic
1067060911 10:43077488-43077510 GCGGGCGGCGGGCGAAGGGCAGG + Intronic
1067091246 10:43266740-43266762 GGGCGCGGCGTGCGCGGGCCCGG - Intronic
1067116178 10:43437088-43437110 GGGCGGGGCCGCCGAGGGGCGGG - Intronic
1067293279 10:44959690-44959712 GGCCGTGCCGGGCGAGAGGCGGG + Intronic
1067474467 10:46556749-46556771 GGCCGCGGCGGGGCGGTGGCAGG - Intergenic
1067686098 10:48466739-48466761 GGCCGGGGCGGGCGGGCGGCGGG - Intronic
1068690195 10:59906425-59906447 GGCCGCGGCGGGCTGGGGAAAGG + Exonic
1068767400 10:60778696-60778718 GGCCTCGGGGGGCGGTGGGCAGG + Intronic
1068878046 10:62018600-62018622 GGTGGGGGCGGGGGAGGGGCAGG - Intronic
1069564002 10:69451359-69451381 GGAGGGGGCGGGCCAGGGGCGGG - Intergenic
1069582046 10:69572933-69572955 GGGCGGGGCGGACGTGGGGCAGG + Exonic
1069698337 10:70404246-70404268 GGCGGCGGCGGGAGCGGAGCGGG + Intergenic
1069761810 10:70816245-70816267 GGCCGGGGCGGGGGCGGGGGCGG + Intronic
1069873136 10:71545252-71545274 GGCCACGGCAGGGGAGGGGGAGG + Intronic
1070257425 10:74824876-74824898 GGCTGAGGCGGGAGGGGGGCGGG - Intergenic
1070660646 10:78303211-78303233 GGCCGCGCGGGCCGAGGGGCGGG - Intergenic
1070914529 10:80144498-80144520 GGGCGGGGCGGGCGGGGAGCAGG - Intronic
1070954384 10:80454625-80454647 AGCCGCGGCGGGCCCGGGGCCGG + Intronic
1071086633 10:81874549-81874571 CGCCGCCGCGAGCCAGGGGCTGG - Intergenic
1071086892 10:81875433-81875455 GGCAGCGGCGGGCGGGGGCCCGG + Exonic
1071579635 10:86757060-86757082 GGCCTCGGCGCGCGCTGGGCCGG + Intronic
1071695261 10:87863437-87863459 GACCGCGCCGGGCGAGGGGAGGG - Exonic
1072190521 10:93073600-93073622 GGCGGCGGTGGGGGAGGGCCAGG - Intronic
1072591492 10:96832266-96832288 GGCCGCGGCGGAGGCTGGGCCGG + Intronic
1072637285 10:97186100-97186122 GGCTGCGGCGGGGGAGGGCGGGG - Intronic
1072710663 10:97713886-97713908 GGCGGCGGCTGGCGCGGGGGCGG - Exonic
1072782098 10:98258116-98258138 GGCCCAGGTGGGCGAGGGCCGGG - Exonic
1073049193 10:100656702-100656724 CGCAGCGGCGGGCGAAGGGGCGG + Intergenic
1073058252 10:100715690-100715712 GGCGGCGGCTGGGGCGGGGCTGG - Intergenic
1073063519 10:100745667-100745689 CGCCGCCGCGGCCGAAGGGCCGG - Intronic
1073146275 10:101284104-101284126 GGGAGCGGGGAGCGAGGGGCGGG + Intergenic
1073207271 10:101775825-101775847 GGGCGCGGGGGGCGGGTGGCGGG + Intronic
1073326106 10:102644595-102644617 GGCGGCCGCGGGCAGGGGGCCGG - Exonic
1073379306 10:103065985-103066007 GGCCCCGGCAGGAGAGGGACAGG - Intronic
1074008942 10:109457049-109457071 GGCCGCGGCGGGGCAGGCGTAGG + Intergenic
1074086197 10:110210225-110210247 GGACGCCTCGGGCGATGGGCTGG - Intronic
1074377406 10:112951340-112951362 GGCCGAGCCGGGCGCGGGGCCGG - Intronic
1074618646 10:115094077-115094099 GGCCGCGACGGGAGCGAGGCAGG - Intronic
1074843285 10:117375441-117375463 GGCGGCGGCGGCAGCGGGGCCGG + Exonic
1074977745 10:118595130-118595152 GGCCTCGGCGGGCAACGGGTCGG - Exonic
1075207069 10:120457162-120457184 GGCGGAGGCGGGCGCCGGGCGGG - Exonic
1075521527 10:123146463-123146485 GGCAGGGGCAGGCGAGGGGGCGG - Intergenic
1075638857 10:124050025-124050047 GGCTGCGGTGGGCGTGGGGGTGG + Intronic
1075748421 10:124743966-124743988 GGCGGCGGTGGCCGGGGGGCTGG - Intronic
1075825773 10:125356181-125356203 GGCCCTGGGGGCCGAGGGGCAGG - Intergenic
1076650243 10:131982240-131982262 CGCCGCGGCGGGCGGTGGGCCGG + Intergenic
1076707137 10:132308110-132308132 GGCCGAGCCGGGGGCGGGGCAGG + Intronic
1076722095 10:132397180-132397202 GGCGGCGGCGGCGGCGGGGCGGG + Exonic
1076792861 10:132786059-132786081 GGGCGCGGGGCGCGGGGGGCGGG + Intergenic
1076861508 10:133140250-133140272 GGCAGGGGCGGGGCAGGGGCGGG - Intergenic
1076861514 10:133140261-133140283 GGCAGGGGCGGGGCAGGGGCGGG - Intergenic
1076864531 10:133160357-133160379 GGCGGGGGCGGGCGAGGGCCGGG + Intergenic
1077043733 11:535453-535475 GGCCGAGGCCGGGGCGGGGCGGG + Exonic
1077043738 11:535459-535481 GGCCGGGGCGGGGCGGGGGCGGG + Exonic
1077062665 11:624765-624787 GGCGGCGGGGAGCCAGGGGCTGG - Intronic
1077090753 11:777267-777289 GGCCGCTGGGGGCGCCGGGCAGG - Intronic
1077095062 11:795735-795757 GGAAGGGGCGGGCAAGGGGCTGG - Intronic
1077100405 11:819918-819940 GGGGGCGGCAGGCGGGGGGCTGG + Intronic
1077103659 11:832890-832912 GGCCGGGGCGGGGCCGGGGCGGG + Exonic
1077107724 11:849325-849347 GCCGGCGGCGGGTGGGGGGCTGG - Intronic
1077204664 11:1336699-1336721 GGGCGGGGCGGGCGGGGGGGCGG + Intergenic
1077204688 11:1336743-1336765 GGGCGTGGAGGGCGGGGGGCGGG + Intergenic
1077204739 11:1336838-1336860 GGGCGTGGAGGGCGGGGGGCGGG + Intergenic
1077211822 11:1374800-1374822 GGCTGCGGGGGGCGGGGGGAGGG - Intergenic
1077231695 11:1460693-1460715 GCTCGCGGCGGGCGGTGGGCGGG - Exonic
1077253958 11:1572421-1572443 GGCTGCCGCGGGGGGGGGGCGGG + Intergenic
1077254651 11:1574729-1574751 GGCCGCGGCGAGGGACGTGCGGG + Intergenic
1077322113 11:1947188-1947210 GGGCGGGGCGGGCGCAGGGCTGG + Intergenic
1077409173 11:2395525-2395547 GGCCCCGGGGGGCGAGGGCGGGG + Intronic
1077491501 11:2862921-2862943 GGGGGCGGCGGGCGCGGGCCCGG + Intergenic
1077495119 11:2883246-2883268 GAACCCGGCGGACGAGGGGCCGG + Exonic
1078139669 11:8682951-8682973 GGCCGGCGCGGGCCCGGGGCGGG + Intronic
1078632017 11:13011106-13011128 GGGGGCGGGGGGCGGGGGGCGGG + Intergenic
1079129261 11:17737999-17738021 TGTCGGGGCGGGCGGGGGGCAGG + Intronic
1079361947 11:19777106-19777128 GGCCGCGGCGGCCGAGGGCGGGG - Intronic
1080034897 11:27700531-27700553 GGGAGCGGGGGGCGGGGGGCGGG - Intronic
1080389080 11:31827237-31827259 GCCCGCGGCGGGCGAGCGGGCGG - Intronic
1080551407 11:33376413-33376435 AGCCGCGGCGGGTGCGGGCCGGG - Intergenic
1080606708 11:33869870-33869892 GGGGGCGGCGGCCTAGGGGCGGG + Exonic
1080779945 11:35420102-35420124 GGGGGCGGCGGGCGGGGTGCAGG + Intergenic
1080902636 11:36510273-36510295 GGCTGCGGGGAGCGAGGGGCAGG + Intergenic
1081705578 11:45180660-45180682 GGGCCTGGCGGGCGGGGGGCGGG + Intronic
1081720687 11:45286211-45286233 GCCCGCTCCCGGCGAGGGGCTGG + Exonic
1081863445 11:46347257-46347279 GGCCGGGCCGGGCTGGGGGCAGG + Intronic
1081967191 11:47177135-47177157 GGTTGCGGCGTGGGAGGGGCGGG - Intergenic
1083428691 11:62602534-62602556 GGGCGCTGGGGGCGCGGGGCCGG - Exonic
1083448492 11:62726943-62726965 GGCCGCGTCGGGCGGCGGCCCGG - Exonic
1083460029 11:62805196-62805218 GGGAGCGGCGCGCGGGGGGCCGG - Intronic
1083613443 11:64015164-64015186 GGGCACCGAGGGCGAGGGGCAGG + Intronic
1083648005 11:64184240-64184262 GGCCGAGGCGGGGGGGGGGGGGG + Intergenic
1083657039 11:64234717-64234739 GGGCGCGGCGGGCGGGGGCCGGG - Exonic
1083659839 11:64246881-64246903 GGCCGCGGGGGACAAAGGGCGGG - Exonic
1083682800 11:64359087-64359109 GGCCGCGCAGGGCGGGGAGCCGG + Intergenic
1083743457 11:64722922-64722944 GGCGGAGACGGGCGGGGGGCGGG - Intronic
1083876009 11:65524924-65524946 GGGAGGGGCGGGAGAGGGGCGGG - Intergenic
1083880856 11:65547602-65547624 GGAGGCGGCGGGCAAGGGGAGGG + Intronic
1083886215 11:65574586-65574608 GGCCCCGGCGGGGGCGGGGGAGG + Intergenic
1083897495 11:65627387-65627409 GGCAGCTGTGGGCAAGGGGCAGG - Exonic
1083933687 11:65859533-65859555 GGCCGCGGCGGGCGGGAGGCGGG + Intronic
1083941809 11:65900089-65900111 GGCCCCGGACGGCGAGGGGCAGG + Intronic
1083966995 11:66049201-66049223 GGGGGCGGGGGGCGGGGGGCGGG - Intergenic
1083970206 11:66070048-66070070 GGCCGCGGCCGGCCGTGGGCGGG + Intergenic
1083998447 11:66283656-66283678 GGCCTCTGCGGCCAAGGGGCAGG - Exonic
1084035768 11:66509328-66509350 GGCTGGGGAGGGGGAGGGGCAGG + Exonic
1084155301 11:67309897-67309919 GGTTGGGGCGGGCGATGGGCCGG - Exonic
1084179722 11:67440304-67440326 GGGCAGGGCTGGCGAGGGGCAGG - Intronic
1084301657 11:68256449-68256471 GACAGCGGCGGGGGAGGAGCGGG - Intergenic
1084332869 11:68439922-68439944 GGGCGGGGCCGGGGAGGGGCGGG + Intronic
1084415909 11:69032888-69032910 GTCCACGGTGGGCCAGGGGCTGG - Intergenic
1084452933 11:69250803-69250825 GGCTGCTGCGGACGAGGAGCTGG + Intergenic
1084527244 11:69704817-69704839 GGCCGGGGCGAGCGCGGAGCAGG - Intergenic
1084546922 11:69819254-69819276 GGCGGAGGCGCGGGAGGGGCGGG + Intergenic
1084546969 11:69819430-69819452 GGAGGGGGCGGGGGAGGGGCGGG - Intergenic
1084621109 11:70270784-70270806 GGCCGCGGCGTGGGGCGGGCAGG + Exonic
1084637249 11:70399914-70399936 GGCCGTGGCGCAGGAGGGGCTGG + Intronic
1084871738 11:72103156-72103178 GGCCGCGGCAGGCGGGGCTCGGG - Intronic
1084888399 11:72224732-72224754 AGAGGCGGCGGGGGAGGGGCAGG - Intronic
1084946689 11:72642483-72642505 GCCGGGGGCGGGCGGGGGGCGGG - Intronic
1084946697 11:72642494-72642516 GGCCGGGGCGGGCCGGGGGCGGG - Intronic
1085284642 11:75351758-75351780 CGACGCGGCGGGCGGCGGGCGGG - Intergenic
1085296686 11:75435363-75435385 GGCTGCGGCTGACAAGGGGCTGG + Exonic
1085336592 11:75701358-75701380 GGCTGGGGCGGGAGAGTGGCAGG - Intergenic
1085506984 11:77066543-77066565 GGCCGCGGCTGACTTGGGGCCGG - Intergenic
1085666218 11:78417615-78417637 GGGCGCGGCCGCCCAGGGGCGGG - Intronic
1086981065 11:93198015-93198037 GGGCACCGCCGGCGAGGGGCGGG + Intergenic
1087014621 11:93543235-93543257 GGCGGCGGCGGCGGCGGGGCGGG - Intronic
1088648522 11:111937445-111937467 GGCGGCGGCGGCCGCCGGGCTGG + Intronic
1088823491 11:113475306-113475328 GGCGGGGCCGGGCGCGGGGCGGG + Exonic
1088893126 11:114059876-114059898 GGCTGCGGTGAGTGAGGGGCCGG + Exonic
1089198185 11:116707566-116707588 GGCCGCCGCGGGTGGGGTGCGGG - Intergenic
1089284339 11:117396002-117396024 GGCAGCGGCTGGCGATGGGGGGG - Intronic
1089442805 11:118530931-118530953 GGCGTCCGCGGGCGAGGGGACGG + Exonic
1089525624 11:119094803-119094825 GGCGAAGGCGGGCGAGGGGAGGG + Exonic
1089533847 11:119149208-119149230 GGCCGGGGCGGGGCCGGGGCGGG - Exonic
1089537403 11:119169087-119169109 GGCCGCGCTGAGCGGGGGGCAGG + Exonic
1089993419 11:122882880-122882902 CGCCGGGGCGGGCGGGGGCCCGG + Exonic
1090198889 11:124839825-124839847 GGCCGCGGGGCGGGAGGGGAAGG - Intergenic
1090293880 11:125569524-125569546 GCCTGCGGTGGGCTAGGGGCAGG + Exonic
1090345200 11:126063405-126063427 GGCGGGGCGGGGCGAGGGGCGGG - Intergenic
1090635802 11:128689862-128689884 GGCCGCGGCGGCGGGAGGGCCGG - Intronic
1090832412 11:130428475-130428497 GGCGGCGGCGCGGGAGGAGCGGG - Exonic
1091225739 11:133955896-133955918 GGCGGCGGCGGGGGAGGGGAGGG - Intronic
1091286687 11:134412081-134412103 GGAGGCGGGGGGCGGGGGGCGGG + Intergenic
1202805129 11_KI270721v1_random:2501-2523 GGGCGGGGCGGGCGCAGGGCTGG + Intergenic
1091434020 12:459907-459929 GGCGGGGGCGGGGGCGGGGCCGG + Intergenic
1091558627 12:1594287-1594309 GCCCGGGGCGGGGGAGGGCCGGG - Intronic
1091567897 12:1661870-1661892 GGCGGCGGGGGGCGGGGGGCGGG + Intergenic
1091567915 12:1661904-1661926 GGCGGCGGGAGGCGGGGGGCGGG + Intergenic
1091616424 12:2053817-2053839 GGGCCCGGAGGGGGAGGGGCGGG - Intronic
1091740777 12:2959280-2959302 CGCGCGGGCGGGCGAGGGGCCGG - Intergenic
1091888067 12:4031250-4031272 GGGCGCGGCGGGCGGGCGGGAGG - Intergenic
1091916177 12:4272967-4272989 GGCCGCCGCAGGCCGGGGGCAGG - Intergenic
1092108910 12:5945319-5945341 GGCGGCAGCCGGCGAGGGGCGGG - Intronic
1092169301 12:6363392-6363414 GCCAGGGGCCGGCGAGGGGCGGG + Intronic
1092229019 12:6766669-6766691 GGCCGGGGCTGGCGGGGAGCCGG - Exonic
1092538129 12:9405128-9405150 GCCAGCGGGGGGAGAGGGGCTGG - Intergenic
1092751117 12:11719972-11719994 GGCCACGGTGGGAGAGGGGGCGG - Intronic
1093711611 12:22334806-22334828 GGTCCCGGCGGGCGAGGCGGAGG - Intronic
1094515366 12:31122569-31122591 GGCCGGGGGGGAAGAGGGGCTGG - Intergenic
1095773634 12:45990084-45990106 GGCGGCGGCGGCCCAGGGCCGGG + Intronic
1096078317 12:48818364-48818386 GGCTGCGGCGGGGGAGGGAGGGG - Intronic
1096336937 12:50764046-50764068 GGCGGGGGCGGGGGAGGGGAGGG - Intronic
1096495461 12:52037169-52037191 GGCGGCCGCGGGCGCGGGGGCGG + Intronic
1096675146 12:53222003-53222025 GGCGGGCGCGGGGGAGGGGCGGG + Intronic
1096700634 12:53380529-53380551 GGCCGGGGCGGGCAGGGGGCGGG - Intronic
1096783878 12:54006224-54006246 GGCCGGGCCGGCCGAGGCGCGGG - Intronic
1096784411 12:54009045-54009067 GGCGGCGGCGGGCGGCGAGCGGG - Intronic
1096816959 12:54207889-54207911 GGCCGAGGAGGGCGATGGGAAGG - Intergenic
1096969689 12:55655752-55655774 GACGGCGGCGGGTGGGGGGCGGG - Intergenic
1096983618 12:55743133-55743155 GGGCGGGGCGGGCGGGCGGCCGG - Intergenic
1097046170 12:56189234-56189256 GGAGGCCGCGGGGGAGGGGCTGG + Intronic
1097107676 12:56634972-56634994 GGCGGCGGCGGCAGAGGCGCAGG + Intronic
1097691565 12:62738988-62739010 GGCGGGGGCGGCGGAGGGGCGGG + Intronic
1097929632 12:65169842-65169864 GGCGGCGGCGGCCGCGGGGATGG + Exonic
1098106003 12:67069406-67069428 GGCCGGGCCGGGCCGGGGGCGGG + Intergenic
1100260660 12:92929342-92929364 GCCCGCGGCCGCCGGGGGGCGGG + Intergenic
1100444804 12:94650510-94650532 GGGAGCCGCGGGCGAGGGGGCGG + Exonic
1100447942 12:94678532-94678554 GGGCGCGGCGGGGGTGGGGTGGG - Intergenic
1100611491 12:96194787-96194809 GGGCGCGGTGGGGGTGGGGCGGG + Intronic
1100632296 12:96400602-96400624 GGCGGAGGCGGGGGCGGGGCCGG + Intergenic
1100982553 12:100172949-100172971 GGCTGCTGAGGGGGAGGGGCTGG + Intergenic
1101371947 12:104138308-104138330 GGCCGCGGCGGGCGGGCGCGCGG - Intergenic
1102003575 12:109573863-109573885 GGCGGCGGCAGGTGAGAGGCCGG + Exonic
1102253997 12:111405857-111405879 GGCCGCGACAGGGGCGGGGCAGG - Intergenic
1102300335 12:111766859-111766881 GGCGGGGGCGGGCCGGGGGCGGG - Intronic
1102471418 12:113161860-113161882 GGGCGTGGCTGGGGAGGGGCGGG - Intronic
1102566978 12:113803303-113803325 GGCAGCGGCGGGCGGCGGGCAGG - Intergenic
1102853922 12:116277387-116277409 GGCGGCGGCGGCTGAGGAGCAGG - Intergenic
1103091996 12:118104058-118104080 GGTCCCGCCGGGCCAGGGGCGGG + Intronic
1103309021 12:119989687-119989709 CGCCGGCGCGGGGGAGGGGCGGG + Intergenic
1103410800 12:120710385-120710407 GGGCCCGGCGGGGAAGGGGCGGG - Intergenic
1103510043 12:121467601-121467623 GGCCGGGCCGGGCGGGGCGCGGG - Intronic
1103659235 12:122500550-122500572 GGCAGCGCCGGGCGAGGGCGAGG - Exonic
1103659244 12:122500573-122500595 GGCAGCGCCAGGCGTGGGGCCGG - Exonic
1103701199 12:122849524-122849546 GGCCGCAGGGGCCGTGGGGCTGG + Intronic
1103722148 12:122980787-122980809 GGCCGCGAAGGGCGCGGGGCTGG + Exonic
1103764531 12:123271275-123271297 GAGCGCGGCGGGCGAGGGCGAGG - Intronic
1103888790 12:124223051-124223073 AGCCGCCGTGGGCGAGGGGAGGG - Intronic
1103927671 12:124432854-124432876 GGCGGCGGGGGGCGGGGGGTGGG + Intronic
1103979143 12:124725010-124725032 GGCCGAGGCGGGCGGAGGTCGGG - Intergenic
1104039144 12:125118146-125118168 GGCTGTGGCGGGCGGGAGGCAGG + Intronic
1104127537 12:125861881-125861903 GGCCGAGGTGGCCGCGGGGCGGG + Intergenic
1104376187 12:128267102-128267124 GGCGGGGGCGGGGGCGGGGCCGG + Intergenic
1104697093 12:130872005-130872027 GGGCGGGGCCGGCGCGGGGCGGG - Exonic
1104697146 12:130872173-130872195 GGCGGCGGCGGGATAGGGGTCGG + Intronic
1104718357 12:131031097-131031119 GGCCCCGGGGAGCCAGGGGCTGG + Intronic
1104809672 12:131612643-131612665 GGCCGAGGCGGGGGAGAGGTGGG - Intergenic
1104836833 12:131797273-131797295 GGCCGCGGGGGCCGCGGGCCGGG - Exonic
1104846587 12:131850188-131850210 GGCAGCTCCAGGCGAGGGGCTGG - Intronic
1104901159 12:132190193-132190215 CCGCGCGGCGGGAGAGGGGCCGG - Intergenic
1104947614 12:132423589-132423611 GTCCGCGGAGGGAGAGGGGCAGG + Intergenic
1104961521 12:132490425-132490447 GGCGGCGGCGGGCGGCGGGCCGG - Exonic
1104980577 12:132571551-132571573 GGCGGGGGCGGGCGTGGGGCGGG + Intronic
1105011985 12:132762019-132762041 GGGCGCGGCAGGCGGGGCGCGGG + Intergenic
1105441018 13:20415388-20415410 GGCTGCGGCGGGCGACAGCCAGG + Intronic
1105745723 13:23375522-23375544 AGCCGCGGCGGCCGAGGAGCAGG + Intronic
1105779637 13:23695440-23695462 GGCTGTGGCCGGCGAGGTGCTGG - Intergenic
1106087621 13:26557673-26557695 GGCCGCGGCCGTGGACGGGCCGG + Intergenic
1106422546 13:29595697-29595719 GGGCGCGGAGCGCGAGGGGCGGG - Intergenic
1106517084 13:30465183-30465205 GGCGGCGGCGGCCGGGCGGCGGG - Intronic
1107467638 13:40665131-40665153 GGGCGCGGCGGGGGAGGGCGCGG - Intronic
1107534173 13:41311652-41311674 GGCGGCGGCCGGCGCGGGCCAGG + Intronic
1108053920 13:46467610-46467632 TGCCGGGGGGGACGAGGGGCTGG - Intergenic
1108643566 13:52405875-52405897 GGCCGAGGCGGGTGTGGGGAGGG + Intronic
1108648814 13:52455665-52455687 GGCGGTGGCGGGCGCGGGCCCGG + Intronic
1111397227 13:87678641-87678663 GGCAGGGGCGGGGGAGGGGGAGG - Exonic
1112012122 13:95301321-95301343 GGGCGGGGCGGGCGCGGGCCGGG + Exonic
1112216258 13:97434115-97434137 GGCGGCGGCGGGCGGGGATCTGG + Intergenic
1112271599 13:97975233-97975255 GGCCGAGGCGGGGGGAGGGCGGG + Intronic
1113312118 13:109141233-109141255 GGGCGCGGGGGGCGAGGCACTGG - Exonic
1113378814 13:109785568-109785590 GGACGCGGCGGGCGCGGCGGCGG + Exonic
1113378858 13:109785855-109785877 GGCGACGGCGGGCGGGGGGTCGG - Exonic
1113493984 13:110713802-110713824 GGCAGCGGCGGCCGCGGCGCTGG + Intronic
1113794739 13:113050659-113050681 GGCCGGGGCGGTGGAGGGGGGGG + Intronic
1113841601 13:113364258-113364280 GGCAGGAGCGGGGGAGGGGCAGG + Intergenic
1113841640 13:113364342-113364364 GGCAGGAGCGGGTGAGGGGCGGG + Intergenic
1114193986 14:20461228-20461250 GGGCCCGGCGGGAGTGGGGCTGG - Exonic
1114259144 14:21025103-21025125 GGCTGGGGCGGGCCGGGGGCGGG - Intronic
1114259201 14:21025228-21025250 GGGGCCGGGGGGCGAGGGGCGGG + Intronic
1114270686 14:21098354-21098376 GGCGGCGGCGGGCGGCGGGCCGG + Exonic
1114516169 14:23301623-23301645 GCGCGCGGCGGGGGCGGGGCCGG + Exonic
1114516314 14:23302162-23302184 GGAGGCCGCGGGCGCGGGGCTGG + Exonic
1115028389 14:28767460-28767482 GGCGGCGGCGGTTGCGGGGCGGG - Exonic
1115398577 14:32934884-32934906 GGCCGCGGCGGCCGGCGGGGCGG + Intergenic
1115399193 14:32938961-32938983 GGCGGCGCCGGGCGAGCAGCGGG + Intronic
1115545546 14:34462349-34462371 GGCCGGGGCGCGCGCGGGTCTGG - Exonic
1115566586 14:34630049-34630071 GGGGGCAGCGGGCGCGGGGCGGG - Intronic
1115592210 14:34874959-34874981 GGCGGCGGCGGGCGAGGAGCCGG - Intronic
1115985808 14:39102982-39103004 GGCGGCGGCGGGCTGGGGGCTGG - Intronic
1117141121 14:52791710-52791732 GGACCAGGAGGGCGAGGGGCGGG + Intergenic
1117141138 14:52791751-52791773 GGACCAGGAGGGCGAGGGGCGGG + Intergenic
1117895830 14:60485769-60485791 GGGCGCGGCGGGGGATGGGGGGG - Intronic
1117974085 14:61280889-61280911 CGCCGCGGCTGGCCAGGGCCGGG - Exonic
1118206493 14:63728086-63728108 GGGCGCGGCGCGCGCGGGGCGGG - Intergenic
1118258577 14:64226332-64226354 GGCCACGGCGGGGGTGGGGGCGG + Exonic
1118568787 14:67172243-67172265 GGATGCGGCGGGCGGCGGGCTGG - Intronic
1118576001 14:67241591-67241613 GAGCGCGGCGGGGGAGGGGCGGG + Intronic
1118672332 14:68143000-68143022 AGGCGCGGAGGGCGAGGGGGTGG + Intronic
1119003907 14:70907528-70907550 GGCCGCGGGTGGCGGGGGCCGGG + Exonic
1119410278 14:74426080-74426102 GGCGGCGGCGGGCTGCGGGCGGG - Exonic
1119538135 14:75419581-75419603 GGCCTAGGCGGGGGAGGGGTGGG - Intergenic
1119649911 14:76376244-76376266 GGCCGCGGCGGGGGAGAGGGAGG - Intronic
1119750861 14:77076469-77076491 GTCAGGGGCGGGGGAGGGGCGGG - Intergenic
1120545674 14:85808714-85808736 TGCGGCGGCGGGCGGGGGGGTGG + Intergenic
1120788021 14:88554718-88554740 GGCTGCGGCGGCCGCGCGGCGGG - Exonic
1121473434 14:94174207-94174229 GGCCGAGGCGGGCAAGGTGGCGG + Intronic
1121617066 14:95320104-95320126 GGGCGGGGCGGGGCAGGGGCGGG + Intergenic
1121690799 14:95876241-95876263 GGCTGCGGCAGCCGAGGGGCGGG - Intergenic
1122081956 14:99272798-99272820 GGTCGCGGGCGGCGAGGGGAGGG + Intergenic
1122082035 14:99273235-99273257 GGCCGAGGAGCGCGGGGGGCGGG - Intergenic
1122130722 14:99603436-99603458 GGCGGCGGCGGGGGCGGCGCCGG - Exonic
1122145079 14:99684175-99684197 GGGCGGGGCGGGGGAGGGCCCGG + Intergenic
1122275210 14:100587438-100587460 GGCCGGGGCTGGCGGGGAGCCGG - Intergenic
1122543298 14:102509492-102509514 GGCGGCCGCGGGCGCGGCGCGGG + Intronic
1122544846 14:102516754-102516776 GCCCGAGGCGGGGAAGGGGCCGG + Intergenic
1122602691 14:102929457-102929479 GGCAGCGGCCGCCCAGGGGCTGG - Exonic
1122649912 14:103220631-103220653 GGCTGCGGGGGGCGAGGGGAGGG - Intergenic
1122666652 14:103334607-103334629 GGGCGCGGCGGGCCAGGAGATGG + Intronic
1122688678 14:103521635-103521657 GGCCGCTGTGGGCGCGGGGCTGG + Intronic
1122693737 14:103543061-103543083 GGCCGAGGTGGGGGAGGGGACGG + Intergenic
1122782241 14:104148656-104148678 GGCCGGGGAGGGGGAGGGGGAGG + Intronic
1122840772 14:104461617-104461639 GGGCGGGGCGGGGGCGGGGCGGG + Intergenic
1122904549 14:104795765-104795787 GCGCGGGGCGGGCGCGGGGCGGG - Intergenic
1122904555 14:104795776-104795798 GGCGGCTCCGGGCGCGGGGCGGG - Intergenic
1122917432 14:104865524-104865546 GGCCGCGGCCAGCGCTGGGCCGG - Intronic
1123014112 14:105365437-105365459 GCCCGCAGCGGGCCAGGGGCGGG - Intronic
1123024838 14:105419741-105419763 GGCCGCGGGCGGCGCGGGGTCGG + Intronic
1123898069 15:24848241-24848263 GGCGGCGGCGGGGGCGGGGGCGG + Intronic
1124109545 15:26773223-26773245 GGCCGAGGCGAGCGTGGGGGAGG - Intronic
1124355777 15:28993764-28993786 GGAGGCGGTGGGCGATGGGCAGG + Intronic
1124426984 15:29570759-29570781 GGCGGCGGCGCGCGCCGGGCCGG - Intergenic
1124427024 15:29570875-29570897 GGCCGGGCCGGGCGGGGAGCCGG + Intergenic
1124427061 15:29570986-29571008 GGCCGGGGAGCGCGCGGGGCGGG - Intergenic
1124453876 15:29822560-29822582 GGCCGCGGCGGGGGAGGGGGCGG + Intronic
1124696378 15:31867897-31867919 GGGAGCGGAGGGGGAGGGGCGGG + Intronic
1124743129 15:32315367-32315389 GGCCGCGCCGGGGCCGGGGCCGG - Intergenic
1125524784 15:40368067-40368089 GTGCGCGCCGGGCGCGGGGCCGG + Exonic
1125525254 15:40370205-40370227 GGCCGAGGGGGGCCAGGGGATGG + Exonic
1125535859 15:40441045-40441067 GGCCGGGGCGGGCGGACGGCGGG - Intronic
1125594236 15:40874069-40874091 CGCCGCCGCGGGGGAGGGGTCGG + Exonic
1125626895 15:41116175-41116197 GGCGGCTGCGGGCGCTGGGCCGG + Exonic
1125674789 15:41496060-41496082 GGCCCCGGCGGGCCTGGGGGTGG - Intronic
1125961677 15:43835292-43835314 GGGGGCGGGGGGCGGGGGGCGGG - Intronic
1126099941 15:45112936-45112958 GGCCGTGGCTCGCGAAGGGCCGG - Intronic
1126113378 15:45187979-45188001 CGCAGCGGCGGGTGGGGGGCGGG + Intronic
1126645843 15:50874221-50874243 GTCTGCGGAGGGCGGGGGGCGGG - Intergenic
1126823567 15:52528612-52528634 TGCCGCAGCGGGCGACCGGCTGG + Intronic
1127103361 15:55588631-55588653 GGGAGCGCCGGGCGCGGGGCGGG - Intronic
1127144116 15:56007300-56007322 GGCGGCGGCGGGGGAGGCGGCGG + Intergenic
1127144124 15:56007318-56007340 GGCGGCGGCGGGGGAGGCGGCGG + Intergenic
1127144132 15:56007336-56007358 GGCGGCGGCGGGGGAGGCGGCGG + Intergenic
1127144140 15:56007354-56007376 GGCGGCGGCGGGGGAGGCGGCGG + Intergenic
1127165775 15:56243813-56243835 GGCCGCGGCGGCGGCGGGGCCGG - Intergenic
1127449598 15:59103910-59103932 GGGGGCGGGGGGCGGGGGGCGGG - Intergenic
1127836539 15:62795213-62795235 GGTGGCTGCGGGAGAGGGGCAGG + Intronic
1128078237 15:64841633-64841655 GGCTGCGGCGGGGGAGGAGAGGG - Intergenic
1128153224 15:65376588-65376610 GGGCGCGGGGGGCGCTGGGCGGG - Intronic
1128269187 15:66293741-66293763 GGCCGGGGCGGGGGCGGGGACGG + Intronic
1129273970 15:74433520-74433542 CGCTGCGGCGAGCGAGCGGCGGG - Intronic
1129287969 15:74541153-74541175 GGCGGGGGCGGGGGCGGGGCGGG - Intergenic
1129386998 15:75201851-75201873 GGGCGGGGCGGGCTGGGGGCGGG - Intronic
1129423979 15:75451657-75451679 GGCCGCGGCGGTAGAGGCGGCGG - Exonic
1129424869 15:75455619-75455641 GGCCGAGGTAGGCGAGGGACAGG - Intronic
1129612349 15:77070861-77070883 GGCCGGGCAGAGCGAGGGGCCGG - Intronic
1129676015 15:77632737-77632759 CCCCGCGTCGGGAGAGGGGCCGG + Intronic
1129958447 15:79660976-79660998 GGCCTTGGAGGGAGAGGGGCTGG + Intergenic
1130115247 15:81000755-81000777 GGACGCTGCCGGCGTGGGGCCGG - Intergenic
1130224415 15:82046316-82046338 GGCTGCGGCGAGCGCGGGGGTGG - Intergenic
1130317555 15:82809681-82809703 GGGCTCGGCGGGCGCGGGCCTGG - Exonic
1130540347 15:84817362-84817384 GGCGGCGGCGGGCAGGGGCCCGG + Exonic
1130540366 15:84817410-84817432 GGCAGCGGCGAGTGCGGGGCCGG + Exonic
1130564427 15:84981701-84981723 GGCGGCGGCGGGAGCGGGGCCGG + Intronic
1131144349 15:90001686-90001708 GGGCGCGGGGGGCGCGGGGGTGG + Intronic
1131977611 15:97961357-97961379 AGGCCCGGCGGGCCAGGGGCGGG - Intronic
1132055300 15:98647654-98647676 GGGCGCGGCGGGCGCTGGGGAGG - Intergenic
1132055636 15:98648846-98648868 GGCGGCGGCGGGCGGGGGCCGGG + Intergenic
1132055647 15:98648867-98648889 GGCGGGGGCCGGCGCGGGGCGGG + Intergenic
1132512909 16:352924-352946 GGCCGGGGCGTGGGCGGGGCCGG + Intergenic
1132552882 16:560569-560591 AGTCGCGGCCGGCGCGGGGCGGG + Exonic
1132553943 16:564597-564619 GGCCGTGAGGGGAGAGGGGCAGG + Intronic
1132575238 16:660997-661019 GGCCGGGGGGGGGGGGGGGCGGG - Intronic
1132585992 16:705953-705975 GGCCGGGGCGGGGCGGGGGCGGG - Intronic
1132589998 16:722401-722423 GACCGCGGTTGGCGAGGGCCTGG + Exonic
1132604582 16:788421-788443 GGCGGGGGCGGGCCGGGGGCGGG - Intergenic
1132683810 16:1154049-1154071 GCCGGCGGGGGGCGGGGGGCGGG + Intronic
1132741362 16:1414816-1414838 GGCTGCGGGGGGCGCGGGGCTGG - Intergenic
1132807784 16:1783026-1783048 GGCGGCGGCCGGTGAGTGGCGGG + Exonic
1132815901 16:1826474-1826496 GGCCGCGGCGGACGCAGGCCTGG + Intronic
1132840893 16:1978071-1978093 CACCCCGGGGGGCGAGGGGCTGG + Intronic
1132851479 16:2026818-2026840 GGCGGGGGCGGGGAAGGGGCGGG + Intronic
1132889455 16:2196655-2196677 GCGCGCGGCGGGCGCGGGGCGGG + Intergenic
1132947147 16:2537979-2538001 GGGGGCGGCGGGCGACGGGGCGG + Exonic
1132954382 16:2583748-2583770 GGCAGTGGCGGGTGAGGTGCTGG + Intronic
1132959963 16:2616415-2616437 GGCAGTGGCGGGTGAGGTGCTGG - Intergenic
1133062297 16:3182930-3182952 GGCGGAGGCGGGCGAGGGCCCGG - Intergenic
1133156544 16:3880392-3880414 GGCGGCGGCGGGCCGCGGGCCGG - Exonic
1133220106 16:4316156-4316178 GGCCGGGACGGGCGGGGGCCGGG - Intronic
1133270549 16:4609094-4609116 GGGGGCGGCGGGCAGGGGGCTGG + Exonic
1133272357 16:4616429-4616451 GGCGGGGGCGGGCGCTGGGCCGG + Intergenic
1133273847 16:4625097-4625119 GGACCCGGCGGGCGCGGGGGCGG + Intronic
1133784396 16:8963510-8963532 CGCCGAGGCGGGCGGGCGGCCGG + Intronic
1133801942 16:9091756-9091778 GGCTGCGGCGGCCGAGGCGAGGG + Exonic
1134149826 16:11797045-11797067 GGCGGCGGCGCGCGCGGGGGGGG + Intronic
1134159618 16:11876492-11876514 GGCCGAGGCGGCAGGGGGGCCGG + Intronic
1134256295 16:12614596-12614618 CGGCGCGGTGGGGGAGGGGCGGG - Intergenic
1134554649 16:15154822-15154844 GGGCGCGGTGGGGGCGGGGCGGG + Intergenic
1134636147 16:15793526-15793548 GGCCGAGGCGGGAGGGTGGCTGG - Intronic
1134831531 16:17327615-17327637 GGCCGAGGCGGGGGGGGGGGGGG - Intronic
1135775999 16:25257904-25257926 CGTCCTGGCGGGCGAGGGGCTGG + Exonic
1136079319 16:27841208-27841230 GTCCCCGGCTGGTGAGGGGCAGG + Intronic
1136110984 16:28063546-28063568 GGCGGCGGCGGACGCGGCGCGGG + Intergenic
1136460637 16:30407975-30407997 GGCCACGGTGGGCGGGGGGGGGG + Intronic
1136547878 16:30965700-30965722 GGAGGCGGCGGGGGAGGGGGAGG - Exonic
1137614519 16:49838786-49838808 GGCCGCGGCGGGGGGCCGGCTGG - Intronic
1137617199 16:49855319-49855341 GGCGGCGGCGGGCGGGCGACAGG - Intronic
1137621037 16:49876711-49876733 CGGCGTGGCGGGCGAGGGGCGGG + Intergenic
1137707910 16:50548281-50548303 GGTTGCGGCGGGGGCGGGGCCGG - Intergenic
1138105427 16:54285145-54285167 GGACACGGGGGGCGAGGGCCTGG - Exonic
1138105884 16:54286948-54286970 GGGCGGGGCGGGGCAGGGGCGGG + Intergenic
1138179319 16:54931404-54931426 GGCGGCGGCGGCCGCGGGGTCGG - Exonic
1138327950 16:56191294-56191316 GGACGGGGAGGGCGCGGGGCGGG - Intergenic
1138591129 16:58000343-58000365 GGGTGCGGCGGGCGCGGGGGTGG + Intronic
1138595129 16:58025738-58025760 GGCCGCGGCGCGCGGGGAGGAGG + Exonic
1139364973 16:66427449-66427471 GGGCGGCGCGGGGGAGGGGCGGG + Intronic
1139402937 16:66696642-66696664 GGCGGCGGCGGGCGGGCCGCGGG - Exonic
1139528087 16:67528764-67528786 GGGCCCGGCGGGCCAGGGGAGGG + Intronic
1139545763 16:67648829-67648851 GGCCGCGAGTGGGGAGGGGCAGG - Intronic
1139637147 16:68264598-68264620 GGGCGCGCCGGGAGCGGGGCCGG + Intronic
1139643594 16:68311089-68311111 TCCCGCGGCGGGTGAGGCGCTGG + Intronic
1139974842 16:70801197-70801219 GGGCGTGGCTGGAGAGGGGCGGG - Intergenic
1140442640 16:74999309-74999331 GGCGGCGGCGAGCGGCGGGCGGG - Exonic
1141132364 16:81444959-81444981 GGGCTCGGCGGGCGACGGGGAGG - Intergenic
1141156775 16:81602576-81602598 CGCTGGGGCGGGCGAGGGGCAGG - Intronic
1141608506 16:85169034-85169056 GGCGGCGGCGGGCGGGAGGGAGG + Intergenic
1141989571 16:87602432-87602454 GGGGGCGGGGGGCGGGGGGCGGG + Intronic
1141989576 16:87602439-87602461 GGGGGCGGGGGGCGGGGGGCGGG + Intronic
1142003067 16:87675181-87675203 GGAAACGGCGGGGGAGGGGCGGG - Intronic
1142250479 16:88989623-88989645 GGCAGCAGCCAGCGAGGGGCCGG - Intergenic
1142286000 16:89171806-89171828 GGCCGAGGCGGGAGCCGGGCCGG - Exonic
1142292973 16:89201206-89201228 GGCCTCGGCGGGCTGGGGGCGGG + Exonic
1142303122 16:89270437-89270459 GGCAGGGGCGGGGGAGGTGCCGG - Intronic
1142378861 16:89720881-89720903 GGCGGCGGTAGCCGAGGGGCTGG + Exonic
1142417010 16:89948725-89948747 GGCAGCAGCGAGCGCGGGGCTGG + Intronic
1203148322 16_KI270728v1_random:1817207-1817229 GGCCGGGGTGGGCGAGGCACTGG - Intergenic
1142586975 17:979847-979869 GGCCGCGGAGGGGGCGTGGCAGG - Intergenic
1142667275 17:1470294-1470316 GGCAGCGGGGGGCGTGGCGCAGG + Exonic
1142695063 17:1628940-1628962 CGGCGGGGCGGGCGGGGGGCTGG - Intergenic
1142763440 17:2053946-2053968 CACCGCGGAGCGCGAGGGGCTGG - Intergenic
1142806155 17:2372274-2372296 GGCTGTGGCGGGCTGGGGGCGGG + Intronic
1142811775 17:2398979-2399001 AGCGGCAGCGGGCAAGGGGCGGG - Intronic
1142811790 17:2399011-2399033 CGCCGCGGCGGGCGGGGGTGGGG - Intronic
1142848148 17:2691964-2691986 GGCGGGGGCGGGGGCGGGGCGGG - Intronic
1143109685 17:4546052-4546074 GGCCAGGGCGGGCCAGTGGCTGG - Intronic
1143167304 17:4903256-4903278 GGCTGGGGCGGGGCAGGGGCAGG - Intergenic
1143283387 17:5771481-5771503 GGTCGGGGCGGGCGGGGGGAGGG - Intergenic
1143477665 17:7211813-7211835 GGCTGCGGCGGGGGGGGGGGGGG + Intronic
1143485372 17:7251316-7251338 GGCCGCGGGGGCCCCGGGGCCGG - Exonic
1143527219 17:7479591-7479613 GGCGGCGGCGGCAGCGGGGCCGG - Intronic
1143586924 17:7855002-7855024 GGCTGGGCCGGGGGAGGGGCAGG + Intergenic
1143750128 17:9021727-9021749 GGCCGCGCCGGGCATGGAGCTGG + Intronic
1144490590 17:15704901-15704923 GGCTGCGGCCGGCCGGGGGCGGG + Intronic
1144682746 17:17206238-17206260 GGCCGCGGCGGCTGTGGGCCTGG - Exonic
1144736881 17:17560341-17560363 GGCCCCGGCTGGCGAGTGGCGGG - Intronic
1144756441 17:17682697-17682719 GGCCGCGACGGCCTAGGGCCTGG - Intronic
1144758561 17:17694614-17694636 CGCCGCGGGCGGGGAGGGGCGGG - Intronic
1144930923 17:18858227-18858249 GGCTGCGGCGGGGCCGGGGCTGG + Exonic
1146062383 17:29614087-29614109 TGCCGGGGTGGGGGAGGGGCTGG - Exonic
1146255988 17:31391787-31391809 GGCGGCGGCGGGCAGGCGGCGGG + Exonic
1146339606 17:32007670-32007692 GGCGGCGGCGGCGGCGGGGCCGG - Intergenic
1146759110 17:35460662-35460684 GGCGGGGGCGGGGGCGGGGCCGG - Intergenic
1146901419 17:36591925-36591947 GGCGGCGGCAGGAGAGCGGCCGG + Exonic
1147015795 17:37490207-37490229 CGGCGCGGCGGGGGAGCGGCAGG - Intronic
1147123713 17:38351965-38351987 GGCCGCGGCGGGCGGGGCTCCGG + Intergenic
1147168706 17:38606052-38606074 GGCGGGGGCGGGGGAGGGGAGGG + Intergenic
1147187749 17:38721998-38722020 GGCTGGGGCGGGAGTGGGGCAGG - Exonic
1147197641 17:38778247-38778269 GGCTGGGGTGGGCGAGGGACAGG + Intronic
1147387103 17:40089169-40089191 GGGCGTGAGGGGCGAGGGGCTGG - Intronic
1147440268 17:40443463-40443485 GGCGGCGGGCGGCGAGGGGCAGG - Exonic
1147617090 17:41836048-41836070 GGCCGGGGTGCGCGAGGGGGCGG + Intronic
1147657370 17:42098494-42098516 GGGCCCGGCGGGGCAGGGGCGGG + Intergenic
1147684163 17:42276817-42276839 GGCCTCGGCGGGAGAGGACCCGG - Intergenic
1147907564 17:43832945-43832967 GGAGGCGGGGGCCGAGGGGCGGG + Intronic
1147971162 17:44219705-44219727 GGCCGGGGCCGGCGGCGGGCGGG - Intronic
1147986090 17:44308562-44308584 GGCCGAGGGGGGCGGGCGGCTGG + Exonic
1148206971 17:45785033-45785055 CGCCGCGGAGGGGAAGGGGCAGG - Intronic
1148323645 17:46771494-46771516 GGGGGCGGCGGGGGCGGGGCGGG + Intronic
1148391399 17:47275646-47275668 GGCCGCCTGGGGGGAGGGGCGGG + Intronic
1148437177 17:47693997-47694019 GGCGGCGGCGGAGGAGGAGCGGG + Intergenic
1148493466 17:48037808-48037830 GGCGGCGGCGGGCAGGCGGCGGG - Intronic
1148502198 17:48100687-48100709 GGACACGGAGGGGGAGGGGCAGG - Intronic
1148645457 17:49217593-49217615 GGGGGCGGGGGGCGGGGGGCAGG + Intronic
1148782451 17:50129622-50129644 GGCCGCGGGGGGCTCCGGGCGGG + Exonic
1148782711 17:50130486-50130508 GGCCGCGGCGGGAGCTGGGCTGG + Intergenic
1150108555 17:62479008-62479030 GGCCGCGGGGGGCGCGGGACCGG - Exonic
1150217209 17:63477355-63477377 GGCCCGGGCGGGGGCGGGGCGGG + Intergenic
1150228729 17:63538360-63538382 GGACGCGGCCGGGGTGGGGCTGG - Intronic
1150278664 17:63916024-63916046 GACCTCGGGGGGAGAGGGGCAGG + Intronic
1150326681 17:64263316-64263338 GGCGGCCGCGGGCGCGGGGCGGG - Intergenic
1150373536 17:64661979-64662001 GGCCGTGGCGGCCGAGGCGCCGG - Exonic
1150407977 17:64919173-64919195 GGCGGCGGCGGCGGCGGGGCCGG + Intronic
1150423088 17:65056241-65056263 GGCGGCGGCGGGTGCGGGGCGGG - Intronic
1150675739 17:67245024-67245046 GGGCGCGGCGGCCCCGGGGCAGG - Intronic
1150692776 17:67378938-67378960 GGGGGCGCCGGGCGCGGGGCGGG + Intronic
1150747325 17:67825995-67826017 GGCCGGGGGGGGCGAGGAGGCGG + Exonic
1150791889 17:68205750-68205772 GGCGGCGGCGGGGCCGGGGCAGG - Intergenic
1150791892 17:68205756-68205778 GGCGGCGGCGGCGGCGGGGCCGG - Intergenic
1150823841 17:68457518-68457540 GGACGGGGCGGGGTAGGGGCGGG - Intergenic
1150823856 17:68457545-68457567 GGACGGGGCGGGGTAGGGGCGGG - Intergenic
1150823871 17:68457572-68457594 GGACGGGGCGGGGTAGGGGCGGG - Intergenic
1150823877 17:68457583-68457605 GGACGCGGCGGGGACGGGGCGGG - Intergenic
1151370813 17:73645125-73645147 GGCAGCGGCGGCCGAGGCGCTGG - Intergenic
1151553820 17:74836734-74836756 GGGCTCTGCGGGCGAGGGGTGGG - Exonic
1151559171 17:74861555-74861577 GGGCGCGGCGGGGCGGGGGCGGG + Intergenic
1151704054 17:75757562-75757584 GGACGTGGCGGGGGTGGGGCAGG - Exonic
1151938878 17:77280966-77280988 GGCCCCGCCGGGCGAGGCGGCGG - Intronic
1151939029 17:77281368-77281390 GGGCGGGGCGGGGGCGGGGCCGG + Intronic
1152111561 17:78359983-78360005 GGCCGCGGCGGGAGCTGGGCCGG + Exonic
1152357716 17:79814836-79814858 GGCGGCGGCGGGAGGGGCGCGGG + Intergenic
1152576295 17:81142767-81142789 GGCTGGGGCGGGGGTGGGGCTGG - Intronic
1152582287 17:81171381-81171403 GGCCCAGGCGGGCCAGGGGCAGG + Intergenic
1152593095 17:81223165-81223187 GGACGCGGCTGGAAAGGGGCGGG + Intergenic
1152617832 17:81346025-81346047 GGCCGCGGGGCGCGGGGCGCTGG - Intergenic
1152628689 17:81399928-81399950 GGCCGGGGCGGGCGCGGGACGGG + Intronic
1152644120 17:81460990-81461012 GGCAGCGGCCAGCAAGGGGCCGG + Exonic
1152711087 17:81870913-81870935 GGACGCGGGGGGCGCCGGGCCGG - Intronic
1152721919 17:81927546-81927568 GGCCGAGGCCGGGGCGGGGCGGG + Exonic
1152739093 17:82011290-82011312 GGCTGGGGCGGGGGTGGGGCTGG + Intronic
1152744182 17:82031590-82031612 GCCGGCGGGGGGCGGGGGGCGGG - Intergenic
1152744187 17:82031597-82031619 GAGCGCGGCCGGCGGGGGGCGGG - Intergenic
1152748435 17:82051713-82051735 GGCCGCGGCCAGCGCGAGGCAGG + Exonic
1152790018 17:82273734-82273756 GGCCGCGGCGCTCCAGGGGCGGG + Intergenic
1152793354 17:82293494-82293516 GGCTGCGGGGAGGGAGGGGCGGG + Intergenic
1152821820 17:82441350-82441372 GGCAGGTGCGGGTGAGGGGCAGG + Intronic
1152821834 17:82441396-82441418 GGCAGGTGCGGGTGAGGGGCAGG + Intronic
1152824946 17:82458778-82458800 GAGCGCGGCGGGCGGGAGGCCGG - Exonic
1152861219 17:82698020-82698042 GGCCGCGGGGCAGGAGGGGCGGG - Intronic
1152870632 17:82751573-82751595 GGGCGGGGCGGGGGCGGGGCGGG - Intergenic
1152880555 17:82812312-82812334 CGGGGCGGCGGGCGAGGGGGAGG - Intronic
1152923975 17:83079383-83079405 GGCCGCGCCGGGCGGCGAGCGGG - Intergenic
1152924150 17:83079873-83079895 GGCGGGGGCGGGCCCGGGGCGGG - Exonic
1152924225 17:83080071-83080093 GCCGGGGGCGGGCGCGGGGCAGG + Intronic
1152924393 17:83080539-83080561 GGCCGCGGCGCGCGCTGCGCTGG + Intronic
1152924490 17:83080868-83080890 GCCCGCGGCGGGGGCGGGGGCGG - Intronic
1153006254 18:500745-500767 GGCCGGGTCGGGCCAGGGGGAGG - Intergenic
1153855090 18:9137213-9137235 GGCGGCGGCGGGCGGGGCCCCGG - Intronic
1154193271 18:12247660-12247682 GGACGGGGCAGGAGAGGGGCAGG + Intergenic
1155075246 18:22348711-22348733 GAAGGCGGCGGGGGAGGGGCGGG + Intergenic
1155284210 18:24271883-24271905 GGCCCGGGCGGGCGCGGCGCGGG - Intronic
1155392719 18:25352302-25352324 GGCGGCGGCGGGCGGGGCTCGGG - Intergenic
1156000536 18:32379457-32379479 GGCCGGGGGGGGTGGGGGGCGGG + Intronic
1156099634 18:33578379-33578401 GGCGGCGGCGCGCGGCGGGCGGG - Intergenic
1156350428 18:36297653-36297675 GGGCGGGGCGGGGGCGGGGCCGG - Intergenic
1156350433 18:36297662-36297684 GGCCGCGGGGGGCGGGGCGGGGG - Intergenic
1156807895 18:41209053-41209075 GGCGGCGGCGGGGGAGGGGAGGG - Intergenic
1157383939 18:47247085-47247107 GGCGGCGGCGGCGGCGGGGCCGG + Intronic
1157384267 18:47248182-47248204 GGCGGCTGCGGCCGAGAGGCTGG + Intronic
1157418559 18:47526317-47526339 GGCCACGGCGGCCAAGGGGGCGG - Intergenic
1157492792 18:48136143-48136165 GGGCGCAGCGGCCGCGGGGCTGG - Intronic
1157604645 18:48918264-48918286 GGTAGCGGCGGAGGAGGGGCAGG - Intergenic
1157827139 18:50822690-50822712 GGGGGCGGGGGGCGGGGGGCGGG - Intronic
1160014112 18:75127695-75127717 GCCTGGGGCTGGCGAGGGGCTGG - Intergenic
1160157018 18:76441948-76441970 GGCCGGGGCGCGCGTGCGGCTGG + Exonic
1160163323 18:76491541-76491563 GGGGGCGGGGGGCGGGGGGCGGG + Intronic
1160164288 18:76496132-76496154 GGCCGGGGTGGGGGAGGGGAGGG + Intronic
1160164304 18:76496161-76496183 CGCGGGGGCGGGGGAGGGGCGGG + Intronic
1160453345 18:78979750-78979772 GGCGGCGGCGGGGGGGGCGCGGG + Intergenic
1160513925 18:79468134-79468156 TCCCACGGCGGGTGAGGGGCAGG - Intronic
1160668421 19:344487-344509 GGCCGGGGTGGGGGAGGGGAGGG - Intronic
1160679993 19:408163-408185 CCCCGCGGAGGGCGAGGGACAGG - Exonic
1160680327 19:409171-409193 GGCGGCGGCGGCGGCGGGGCTGG - Intergenic
1160690983 19:460667-460689 GGTCGCGGGGGTCGCGGGGCGGG - Exonic
1160703103 19:517727-517749 GGCCGAGGCTGGGTAGGGGCTGG + Intronic
1160703301 19:518227-518249 GGCCCCGGCTGGGTAGGGGCTGG + Intronic
1160719077 19:589801-589823 GGGAGGGGCGGGGGAGGGGCGGG - Intergenic
1160719084 19:589812-589834 CCTCGCGGCGGGGGAGGGGCGGG - Intergenic
1160725562 19:616495-616517 GGCCCAGGCGGGCCGGGGGCGGG + Exonic
1160738696 19:676303-676325 GGGCGCGGCGCGGGAGTGGCGGG - Intergenic
1160745407 19:709027-709049 GGCCGGGGCGGGCTAAGGCCTGG - Intergenic
1160766818 19:812538-812560 GCCGGGGGCGGGCGGGGGGCGGG - Exonic
1160794933 19:940902-940924 GGCCCTGGCGGGCGAGGGGTGGG + Intronic
1160859006 19:1229828-1229850 GGCCGCGGCGCGGGCGGGGAGGG + Exonic
1160991766 19:1863129-1863151 GGCGGCGGAGGGCGCGGCGCCGG + Exonic
1161006664 19:1940716-1940738 GGCGGTGGCGGGCGCGGCGCGGG - Intergenic
1161015099 19:1979451-1979473 GGCCTCGGCGGGGGTGGGGGTGG - Intronic
1161128876 19:2576433-2576455 GGCCGCGGCAGGCGGGGGACGGG + Intronic
1161166789 19:2791961-2791983 GGGCGAGGGGCGCGAGGGGCCGG - Intronic
1161218972 19:3109247-3109269 GGCAGAGGCAGGAGAGGGGCTGG + Intronic
1161337566 19:3722567-3722589 CGCCGTGGCGGGGGCGGGGCGGG + Intronic
1161399236 19:4060120-4060142 TGACTCGGCGGCCGAGGGGCAGG + Intronic
1161403279 19:4078261-4078283 GGCCGGGGCGGGGGGGGGGGGGG + Intergenic
1161450705 19:4343860-4343882 GGCGGCGGCGGGGCCGGGGCGGG + Exonic
1161461540 19:4400486-4400508 CGCCGGGGCGGGCGCGGAGCTGG - Exonic
1161471142 19:4457359-4457381 GGGCGCGGCGGGGGAGGCGAGGG - Intronic
1161483751 19:4523875-4523897 GGCCGCGCTGGCCGAGGGCCGGG - Exonic
1161505076 19:4639503-4639525 GGCCGGGGCCGGGGCGGGGCGGG - Intronic
1161583930 19:5094981-5095003 GGCGGCGCCGGGGGCGGGGCAGG + Intronic
1161692545 19:5745184-5745206 GGCCGCGGCGGCGGAGGGTGGGG - Intronic
1161925126 19:7294125-7294147 GGCCGCAGCGGCCGGGGGGTCGG - Intergenic
1161950174 19:7463512-7463534 GGCCGCCCTGGGCCAGGGGCTGG - Intronic
1161998890 19:7730957-7730979 GGCCGCGATGGGAGGGGGGCCGG - Intronic
1162034676 19:7932557-7932579 GGCTGCGGCGGGGGAGGTGGTGG + Intronic
1162035093 19:7934275-7934297 GGCCCTGGCGGCCGGGGGGCGGG + Intronic
1162315490 19:9936153-9936175 GGTCGCAGCGGGGGAGGGGCCGG - Intronic
1162396453 19:10420442-10420464 AGCCGCGGCGGGCGGGGGGCGGG + Intronic
1162464661 19:10832546-10832568 GGCCCCTGCAGGAGAGGGGCCGG + Exonic
1162469456 19:10863684-10863706 GGCCGAGGCGGGTGTGGGTCAGG + Intronic
1162470941 19:10871711-10871733 GGCGGCGGCGGCGGTGGGGCCGG + Exonic
1162535839 19:11262474-11262496 GGCGGCGGCGGCGGCGGGGCCGG - Intronic
1162540663 19:11294006-11294028 GGCTGGGGCGGTCGAGGGGCGGG + Intergenic
1162687687 19:12401025-12401047 TCCCGAGGCGGGGGAGGGGCTGG - Intronic
1162751753 19:12833839-12833861 GGCGGCGGCGGCTGAGGGGAGGG - Intronic
1162798242 19:13097662-13097684 GACCTCTGCGGGGGAGGGGCCGG - Intronic
1162861056 19:13506124-13506146 AGCGGAGGCGGGCGAGGAGCCGG - Exonic
1162934159 19:13972870-13972892 GGCGGCGGCGGGGGAGGCGGTGG - Exonic
1162948581 19:14057644-14057666 GGGCGGGGCGGGGGCGGGGCCGG + Intronic
1162959638 19:14118158-14118180 GGCCCCGGCGGGCGCCCGGCCGG + Intergenic
1162959644 19:14118177-14118199 GACTGCGGCGCGCGCGGGGCCGG - Intergenic
1163138632 19:15331938-15331960 GTCGGGGGCGGGCGGGGGGCGGG - Intronic
1163154490 19:15432526-15432548 GGCGGCGGCGGGGGTGGGGGCGG + Intronic
1163424876 19:17235847-17235869 CGGCGCGGCGGGCGCGGTGCTGG - Exonic
1163458906 19:17424742-17424764 GCCTGGGGCGGACGAGGGGCGGG - Intronic
1163585467 19:18161280-18161302 GGCCGCGGGGCCCGTGGGGCCGG + Exonic
1163595946 19:18221068-18221090 GGGCGGGGCGGGGGCGGGGCCGG - Intronic
1163635107 19:18433917-18433939 GACCGCGGCGGGCCAGGTGGGGG + Intronic
1163665853 19:18603885-18603907 GGCCGAGGGGGGCGGGGGGCTGG + Intronic
1163666671 19:18606843-18606865 GGCCGGGCCGGGGGCGGGGCCGG - Exonic
1163666674 19:18606848-18606870 GGCCGGGCCGGGCCGGGGGCGGG - Exonic
1163720469 19:18896074-18896096 GGGCACGGCGGGCGAGCGGGCGG - Exonic
1163806995 19:19405658-19405680 GGGCGTGGCGACCGAGGGGCGGG - Intronic
1163818665 19:19483530-19483552 GGCTGCGGCTGGCGAGAAGCAGG + Intronic
1164188477 19:22894035-22894057 GTCCGCGGCGGGAGGTGGGCGGG + Intergenic
1164394383 19:27850772-27850794 GGCCGCGTGGGCCCAGGGGCGGG + Intergenic
1164639244 19:29812327-29812349 GGCCCCGGGAGGCGACGGGCCGG + Intronic
1164658602 19:29942576-29942598 GGCCGAAGGGGGCGAGGGGTCGG - Exonic
1164834953 19:31350411-31350433 GGCTCCCGGGGGCGAGGGGCGGG - Intergenic
1165056150 19:33177379-33177401 GGCCGTGGGAGGCGAGCGGCGGG + Intergenic
1165157280 19:33796265-33796287 GCCGGCGGGGGGCGGGGGGCTGG + Intronic
1165213666 19:34254522-34254544 GCCCGAGGCGGGGGCGGGGCCGG + Exonic
1165349356 19:35267988-35268010 GGCCGCGCGGGGCGGGGGACCGG + Intergenic
1165390038 19:35533603-35533625 GGCAGCGGAGGGCGCGGGGGAGG + Intronic
1165459509 19:35936454-35936476 GGCCGAGGCGGGGGCCGGGCGGG - Intronic
1165493919 19:36141048-36141070 GGCGGCGGCGGGGGAGGCGGGGG + Exonic
1165496099 19:36152522-36152544 GGACGCGGCGGGGCTGGGGCTGG + Exonic
1165758927 19:38309416-38309438 GGCCGCGCAGGGCAAGGAGCTGG - Exonic
1165772886 19:38388813-38388835 TGCCGAGGGGGGCGAGGGGGCGG + Intronic
1165939887 19:39409770-39409792 AGCGGGGGCGGGCGCGGGGCGGG + Intergenic
1165940787 19:39413746-39413768 TGGAGCGGAGGGCGAGGGGCAGG - Intronic
1166055298 19:40284904-40284926 GGCCGCAGCGTGCGCGGGCCGGG - Intronic
1166105967 19:40598210-40598232 AGCCGCGGCGGGGGCGGGGCCGG + Intronic
1166306901 19:41940407-41940429 CGCGGCGGCGGGGGAGGGGCGGG - Intergenic
1166358701 19:42242593-42242615 CCCCGCGGCGGGCGCTGGGCCGG - Exonic
1166361328 19:42254041-42254063 GGGGGCGGCGGGGGAGGGGAGGG + Intronic
1166539534 19:43596046-43596068 GTCCGCCGCGGCCCAGGGGCCGG - Exonic
1166677413 19:44748475-44748497 GGCCTCGGCGGGGGAGGGAGAGG - Intronic
1166721806 19:45001430-45001452 GGCCGGGCCGGGCGGGCGGCGGG - Exonic
1166721814 19:45001447-45001469 GGCTGCGCGGGGCGCGGGGCCGG - Exonic
1166869774 19:45864263-45864285 GCCCGGGGCGGGCGAGGGCGGGG + Exonic
1166876604 19:45901743-45901765 GGCGGCGGCGGGCGAAGCGGAGG - Exonic
1166882945 19:45940219-45940241 GGCCGGGGCGGGCGGCGGGGCGG - Exonic
1166888097 19:45973551-45973573 GGGGGCGGGGGGCGGGGGGCGGG + Intergenic
1167001190 19:46746496-46746518 GGTTGCGGCGGGGGAGGGGGGGG - Exonic
1167251339 19:48399881-48399903 GGGCGGGGCCAGCGAGGGGCGGG + Intronic
1167286450 19:48601228-48601250 GGAGGCGGTGGGCGGGGGGCAGG + Exonic
1167369653 19:49072830-49072852 GGCGGCGGCGGCGGCGGGGCAGG - Exonic
1167376304 19:49114233-49114255 GGGCGCGGCTGGCGCGCGGCAGG + Intergenic
1167379004 19:49127936-49127958 GGACGAGGCGGGCGGGGAGCTGG + Exonic
1167468874 19:49664568-49664590 GGAGGTGGCGCGCGAGGGGCGGG - Intronic
1167505519 19:49869188-49869210 GGAGGTGGGGGGCGAGGGGCGGG + Exonic
1167613412 19:50518070-50518092 GGCCGCGAGGAGCGCGGGGCGGG + Exonic
1167648814 19:50719062-50719084 GGGCGAGGCGGGGGAGTGGCCGG + Intronic
1167889344 19:52527514-52527536 GGCCGGGGCGGGGCCGGGGCGGG - Intergenic
1167940563 19:52942710-52942732 GGGCGGGGCGGGGGCGGGGCCGG + Intronic
1168064017 19:53909337-53909359 GGCCGCGGGGGGTGGGGGGTGGG + Exonic
1168100394 19:54138248-54138270 GGCGGCGGCGGGCGGGGCCCGGG - Intronic
1168295793 19:55376901-55376923 GGGCTCGGCAGGTGAGGGGCTGG + Exonic
1168301515 19:55407590-55407612 GGCTGCGGCCGGCCGGGGGCGGG + Exonic
1168350883 19:55674956-55674978 GGCCGGGGCGGGCGTGGCGTGGG + Intergenic
1168401492 19:56088226-56088248 GGCGGCGGGGGGCGAGGAGCCGG - Exonic
1168536081 19:57172032-57172054 GGGCGGGGCGTGCGAGGGGGCGG + Intergenic
1168536089 19:57172050-57172072 GGCGGGGGCGTGCGAGGGGGCGG + Intergenic
1168536097 19:57172068-57172090 GGCGGGGGCGCGCGAGGGGGCGG + Intergenic
1168536104 19:57172085-57172107 GGGCGGGGCGCGCGAGGGGGCGG + Intergenic
1168536111 19:57172102-57172124 GGGCGGGGCGCGCGAGGGGGCGG + Intergenic
1168536118 19:57172119-57172141 GGGCGGGGCGCGCGAGGGGGCGG + Intergenic
1168536125 19:57172136-57172158 GGGCGGGGCGCGCGAGGGGGCGG + Intergenic
1168536132 19:57172153-57172175 GGGCGGGGCGCGCGAGGGGGCGG + Intergenic
1168536139 19:57172170-57172192 GGGCGGGGCGCGCGAGGGGGCGG + Intergenic
1168536146 19:57172187-57172209 GGGCGGGGCGCGCGAGGGGGCGG + Intergenic
1168536153 19:57172204-57172226 GGGCGGGGCGCGCGAGGGGGCGG + Intergenic
1168594468 19:57664333-57664355 GCTGGCGGCGGGCGAGGAGCTGG + Intergenic
1168654695 19:58118473-58118495 GGCCGGGGCCGGCCCGGGGCGGG + Intergenic
1202683494 1_KI270712v1_random:30079-30101 GGCGGCGGCGGGTGGGGGGGGGG - Intergenic
1202683841 1_KI270712v1_random:31290-31312 GGCGGCGGGGGGGGAGGGGTGGG - Intergenic
925069608 2:956208-956230 GGCAGGGGCGGGGCAGGGGCAGG - Intronic
925419953 2:3703721-3703743 GGCCCCGGCGAGCGAGGAGCGGG + Exonic
925927197 2:8678968-8678990 GGCCGCGGCGGGGCCGGAGCCGG - Exonic
925927630 2:8681772-8681794 GGGAGCGGCGGGCGGGGGGCGGG - Intronic
926077130 2:9951044-9951066 GGCCGCGGTGGGCCAGGAGAAGG + Intergenic
926422929 2:12716830-12716852 GGCCCGGGCGGGGGCGGGGCGGG + Intergenic
927472267 2:23385395-23385417 AGCCGCGGCGGCCGCGGGGCTGG - Exonic
927596628 2:24403158-24403180 GGGGGCGGGGGGCGAGGCGCGGG - Intergenic
927606596 2:24491592-24491614 GGCGGCGGCAGGTGAGTGGCGGG + Intergenic
927652482 2:24920597-24920619 AGCCGCGGCGGAGGAGGGGGCGG - Intergenic
927714276 2:25342093-25342115 GGCCGCGGGGGGCGAGCGGCGGG - Intronic
927809224 2:26172787-26172809 GGCAGCGGCGGGTGGGGGCCGGG + Intergenic
927894998 2:26775867-26775889 GGCCGGGCAGGGCGAGGGGCTGG + Intronic
927917254 2:26945189-26945211 GGCTGGGGTGGGCGAAGGGCTGG - Intronic
927943265 2:27118908-27118930 GGCGGCGGGAGGCGAGGCGCGGG - Exonic
928042320 2:27890697-27890719 GGCCGCAGAGGGGGCGGGGCGGG + Exonic
928149137 2:28810687-28810709 GGCTCGGGCGGGCGGGGGGCAGG + Intronic
928964831 2:36966352-36966374 TGCCGCGGCCGGCGACGGGGCGG - Exonic
928998740 2:37324838-37324860 GGCCGGGGCGCGCGGGGGGCGGG + Intergenic
929604259 2:43224868-43224890 GGCCGCGGAGGCCGAGGAACAGG + Exonic
929936407 2:46297319-46297341 GGGCGCGGAGGGCGGGGGGCGGG - Intronic
929936508 2:46297731-46297753 GCGCGCGGCGGGCTAGGTGCGGG - Exonic
930136046 2:47905412-47905434 GGCCGGGGCGGGCGGGCGGGCGG - Intronic
930730702 2:54725016-54725038 GGCCCCGGCGCGCGGGGGGGCGG + Exonic
931348830 2:61470820-61470842 GGCGGCGGCGGGGACGGGGCGGG + Intergenic
931696345 2:64873569-64873591 GGCTGCGGCGGGAGAGAGGCAGG - Intergenic
932316937 2:70790695-70790717 GGCCCGGGCGGGGGCGGGGCGGG + Intergenic
932496409 2:72147866-72147888 GGCCGCGGCGGGGGAGGGGAGGG + Exonic
932567688 2:72919982-72920004 GGCCGCCGCGGCCGAGGGGCTGG + Intronic
932599335 2:73112990-73113012 TGGGGCGGCGGGCGCGGGGCGGG - Exonic
932699798 2:73984887-73984909 TGCCGCGGTGCGCGGGGGGCGGG + Intergenic
932812423 2:74835617-74835639 GGCCGGGGCCGGGGACGGGCAGG + Intronic
933658085 2:84905588-84905610 TGCTGCGGCGGGTGAGGGGCGGG + Intronic
933684603 2:85133400-85133422 CTCCCCGGCGGGCCAGGGGCTGG + Exonic
933684749 2:85133810-85133832 GGACGAGGGGGGCGAGGAGCAGG + Exonic
933893405 2:86790478-86790500 GCCCAAGGCGGCCGAGGGGCTGG - Exonic
933893460 2:86790726-86790748 GGATGGGGCGGGCGGGGGGCGGG - Intronic
934655989 2:96116968-96116990 GGGCAGGGCGGGCGTGGGGCTGG + Intergenic
934978494 2:98822460-98822482 GGCCGCTCCTCGCGAGGGGCAGG + Exonic
934978592 2:98822792-98822814 GGCGCCGGCGGGCTCGGGGCGGG + Exonic
935275801 2:101474397-101474419 GGGCGCGCGGGGCGCGGGGCGGG + Intronic
935463026 2:103361826-103361848 AGAGGCGGCGGGGGAGGGGCAGG - Intergenic
935463054 2:103361892-103361914 GGCGGAGGCGGGAGAGGGGGAGG - Intergenic
935592165 2:104853849-104853871 GGGGGCGGCGGGGGAGGGGCGGG + Intergenic
935592561 2:104855622-104855644 GGCGGCGGCGGGGGCGGCGCAGG + Exonic
935645287 2:105329562-105329584 GGGCGCGGGGCGCGTGGGGCAGG - Intronic
935760126 2:106312584-106312606 GGGGGCGGGGGGCGAGGGGAGGG + Intergenic
936090949 2:109501136-109501158 GGCAGGGGCGGGGGAGGGTCAGG - Intronic
936163802 2:110103386-110103408 GGACGAGGCAGGGGAGGGGCTGG + Intronic
936433269 2:112482244-112482266 GGCCGCGGCGGGCGCCCGGGCGG + Exonic
936600454 2:113890049-113890071 GGCCGCGGCGGGGCAGGGCGGGG + Exonic
937283680 2:120736819-120736841 GGCCGGGCCGGGCGAGGGGGAGG - Intronic
937284564 2:120741842-120741864 GGCCGCCGCCGGCGAGTGGCGGG + Intronic
938077386 2:128346937-128346959 AGCAGCGGCGGGCGGGGGGCGGG + Intergenic
938260890 2:129894781-129894803 GGCGGCGGCGGGCCAGGGTGTGG - Intergenic
938365038 2:130727655-130727677 GGCTGCGGCGGGCGTGGTCCGGG + Intergenic
938795950 2:134718641-134718663 GGCCGCGCTGGGCGAGGCGCGGG - Intronic
939613022 2:144332551-144332573 GGCCGAGGCGGCCGCGGGCCGGG - Intronic
941762093 2:169254895-169254917 GGCAGCGGCGGGAGGGGGACGGG + Intronic
942042999 2:172083258-172083280 CGCCGCGGCGGGCGCGGGGTCGG - Intergenic
942450941 2:176107703-176107725 GGCCGCGGCGGCCGAGGAGGCGG + Exonic
942811368 2:180004681-180004703 GGGGGAGGGGGGCGAGGGGCGGG - Intronic
942890500 2:180981021-180981043 GGCGGCGGTGGGGGAGGGGGCGG + Intronic
944221806 2:197310734-197310756 GGCGGCGGCGGAGGAGGAGCAGG - Exonic
944237123 2:197450787-197450809 GGCCGCGCCGAGTGCGGGGCCGG - Intergenic
944457641 2:199911660-199911682 GGCGGCGGCCGGGGAGGGACTGG + Exonic
944831206 2:203535304-203535326 GGCGGCGGCGGGAGCGGGGGCGG + Exonic
945189027 2:207166927-207166949 GGCGGCGGCGCCCGCGGGGCGGG - Intronic
945241523 2:207681360-207681382 GGCCGCGGGGGACAAAGGGCGGG + Intergenic
945891598 2:215436191-215436213 GGCTGCGGCGGCCGGCGGGCGGG - Intergenic
946245975 2:218387696-218387718 GGCCGCGGGCTGCGGGGGGCTGG + Intronic
946306596 2:218859964-218859986 AACCGCGGCGCGCGAGGGCCCGG - Exonic
946322025 2:218959907-218959929 GCCCGCGGGGGACGAGGCGCTGG + Exonic
946921419 2:224585146-224585168 CGCCGCGGCTGCCCAGGGGCCGG - Exonic
947117944 2:226791674-226791696 AGCCGCGGCGGGCGCGGGGCGGG - Intronic
947353579 2:229271092-229271114 CGCGCCGGGGGGCGAGGGGCTGG + Exonic
947398980 2:229714119-229714141 GGAAGCGGCGGGCGCGGTGCGGG - Intronic
947399135 2:229714609-229714631 GGGCGGGGCGAGCGGGGGGCGGG + Intergenic
947771281 2:232672329-232672351 GGCCGCGGCAGGGGAGCTGCAGG + Exonic
947992154 2:234496674-234496696 GGCGGCGGCGGGCGGGGCCCAGG - Exonic
947992337 2:234497252-234497274 CGGCGCGGCGCGGGAGGGGCCGG - Intergenic
948487237 2:238288706-238288728 GGCGGCGGCGGGCGCGGGGCCGG - Intronic
948492143 2:238320562-238320584 GGCGGCGGCGGCGGCGGGGCCGG + Exonic
948540010 2:238684194-238684216 GGCCGCGGGGGCCTATGGGCAGG + Intergenic
948645299 2:239400625-239400647 GGCTGCGCGGGGCGCGGGGCGGG + Exonic
948771056 2:240251434-240251456 GTCCTCAGCGGGGGAGGGGCTGG + Intergenic
948801592 2:240435772-240435794 GGCGGCGGCGGCCGAGGAGGCGG - Exonic
948817542 2:240520334-240520356 AGCCGCGGCGGGCGGGCGCCGGG - Intronic
948874702 2:240820360-240820382 GGCCGCCGCGGGGATGGGGCTGG + Intergenic
948963236 2:241356360-241356382 GGACGCGGCGGGCGAGCGAGAGG + Exonic
948988695 2:241541210-241541232 GGCGGGGCCAGGCGAGGGGCGGG + Intergenic
949004286 2:241636820-241636842 GGCCTCGGCGGCCGGGGCGCGGG - Intronic
1168769766 20:407969-407991 GGCCGGGGTGGGCCGGGGGCCGG - Intronic
1168972853 20:1942679-1942701 GGCCGGGGGTGGGGAGGGGCAGG - Intergenic
1169118671 20:3082948-3082970 GGCGGGGGCGGGCCTGGGGCTGG - Intronic
1169216269 20:3796428-3796450 GGAGGCAGCGGGCGAGGGGTGGG - Exonic
1169244597 20:4015583-4015605 GGGCCCGCCGGGGGAGGGGCGGG + Intergenic
1169604449 20:7300974-7300996 GGCGGTGGGGGGCGGGGGGCGGG - Intergenic
1169801247 20:9514748-9514770 GGCCGGGGTGAGCGAGAGGCGGG - Exonic
1170562553 20:17569827-17569849 GGCTCCTGCTGGCGAGGGGCGGG - Intergenic
1170623323 20:18011835-18011857 GGCTGCGGCGAGCAAGGAGCCGG - Intronic
1170951354 20:20938961-20938983 GGCAGTGGAGGGGGAGGGGCGGG - Intergenic
1171217396 20:23362265-23362287 GGCGGCGGGCGGCGAGGGGCCGG - Intronic
1172037004 20:32018177-32018199 GGCGGGGGCGGGGGAGGGGCGGG + Intronic
1172037019 20:32018200-32018222 GGCGGGGGCGGGGGAGGGGCGGG + Intronic
1172037029 20:32018217-32018239 GGCGGGGGCGGGGGCGGGGCAGG + Intronic
1172037032 20:32018223-32018245 GGCGGGGGCGGGGCAGGGGCAGG + Intronic
1172117986 20:32583322-32583344 GGCCGCGGAGGGGGAGGGGGAGG + Intronic
1172218943 20:33258770-33258792 GGCGGCGGGGGGCGGGGGGGGGG + Intergenic
1172358889 20:34298597-34298619 GGCGGCGGCGGGAGGGGGGGGGG + Intronic
1172428619 20:34872857-34872879 GGCTGCGGCGGGGGAGTGGGAGG + Exonic
1173704257 20:45098510-45098532 GGCCGCGGCGTCGGAGGAGCAGG - Exonic
1174017693 20:47502041-47502063 GGCGGTGGCGGGCGAGGGGGTGG + Intronic
1174287701 20:49484012-49484034 GGCAGCGGCGGTCCCGGGGCCGG + Intergenic
1174488444 20:50875527-50875549 GGCCGAGGCGGGCGAGTCACCGG + Intronic
1175210494 20:57350939-57350961 GGGCGGGGGGGGCGGGGGGCGGG + Intergenic
1175399662 20:58693128-58693150 GGCGGCGGCGGGGGTGCGGCGGG - Intronic
1175428896 20:58889297-58889319 GGCGGCGGCGGGCGGCCGGCAGG + Intronic
1175623734 20:60473033-60473055 GGCGGTGGGGGGCGGGGGGCGGG + Intergenic
1175734038 20:61372932-61372954 GGACGCGGAGGGCACGGGGCTGG - Intronic
1175847068 20:62064926-62064948 GGGCGCGGCGGTCGGGGGTCCGG + Exonic
1175847111 20:62065013-62065035 GGGGGCGGCGGGCGCGGGGGCGG + Exonic
1175847119 20:62065031-62065053 GGCGGCGGGGGGCGAGGGCGCGG + Exonic
1175847408 20:62065910-62065932 GCGCGCGGCCGGCGGGGGGCGGG + Intergenic
1175859467 20:62142815-62142837 GGCCGCGGAGCGCGGGGGGTAGG - Intronic
1175874144 20:62221516-62221538 CGCCACGGGGGGCGAGGGGAAGG - Intergenic
1175902786 20:62366666-62366688 GACCGGGGCGGGAGGGGGGCCGG - Intronic
1176016801 20:62938113-62938135 GGCCGCGGCGGAGGCGGGGGCGG - Exonic
1176021985 20:62966722-62966744 GGCCTTGGCAGGTGAGGGGCGGG + Exonic
1176062317 20:63177826-63177848 GGCGGCGGCGCGGGAGGCGCAGG + Intergenic
1176135637 20:63520933-63520955 AGGGGCGGGGGGCGAGGGGCGGG + Intronic
1176169967 20:63692320-63692342 GGCCTGGGCTGGCGAGGGCCTGG + Intronic
1176178787 20:63740215-63740237 CGCCGCGCCGGGCTGGGGGCGGG + Intronic
1176223562 20:63981325-63981347 TGGGGCGGCGCGCGAGGGGCGGG + Intronic
1176234832 20:64049373-64049395 GGGCGCGGCGGGCGCGGCGAGGG + Exonic
1176234885 20:64049553-64049575 GAGCGCGGCGGGCGGGCGGCGGG + Exonic
1176247040 20:64102349-64102371 GGGCGGGGTGGGCGCGGGGCAGG - Intergenic
1176273396 20:64248257-64248279 GGCTGGGGTGGGCGGGGGGCGGG - Intergenic
1176286031 21:5020250-5020272 GGCCGAGGCGGCCGCGGGGGAGG - Intergenic
1176380781 21:6111281-6111303 GGCAGCGGCGGGCTCCGGGCGGG + Intronic
1177819637 21:26016932-26016954 GGGGGCGGGGGGCGGGGGGCGGG + Intronic
1178104150 21:29299309-29299331 GCGGGCCGCGGGCGAGGGGCCGG - Intronic
1178351136 21:31873659-31873681 GGCCGCGGCGAGCGCGATGCCGG + Exonic
1178914472 21:36699025-36699047 GACCGCGGCGGGGGCGGGGGCGG - Intergenic
1179209350 21:39312948-39312970 GGGGGCGGGGGGCGGGGGGCCGG + Intronic
1179375460 21:40846768-40846790 GGCGGCGGCGGGCGGCGGGCGGG - Exonic
1179457255 21:41508104-41508126 GGAGGCGGAGGGCGAGGGGCGGG - Intronic
1179674833 21:42974442-42974464 CGCGGCGGCGGGCGCGGGGCGGG - Intergenic
1179742691 21:43426959-43426981 GGCAGCGGCGGGCTCCGGGCGGG - Intronic
1179833464 21:44012582-44012604 GGGCGCGGCGGTCGTTGGGCGGG + Intronic
1179871150 21:44243225-44243247 GGCCGAGGCGGCCGCGGGGGAGG + Intergenic
1179911984 21:44455487-44455509 GGCCTGCGCGGGCGAGGGGCGGG - Exonic
1179957856 21:44751240-44751262 GGTCGCTGCGGGCGAGGGCCTGG - Intergenic
1180068220 21:45423484-45423506 GGGGGCGGGGGGCGGGGGGCGGG - Intronic
1180559064 22:16601417-16601439 AGCGGCGGCGCGCGGGGGGCGGG + Intergenic
1180891457 22:19291815-19291837 GGCAGGGGCGGGGCAGGGGCGGG - Intergenic
1180891463 22:19291826-19291848 GGCAGAGGCGGGGCAGGGGCGGG - Intergenic
1180953502 22:19731204-19731226 CACCGCCGCGGGGGAGGGGCGGG + Intergenic
1180991830 22:19941722-19941744 GGCCGTGGCGGGCGGGGTGCGGG - Exonic
1181000895 22:19987287-19987309 GGGCGTGGCGGGCGGGGGGCGGG + Intronic
1181017596 22:20080239-20080261 TGCCGCGCCGGGCGAGCGGAGGG - Exonic
1181299182 22:21867407-21867429 GGCGGCGGCGGGCGCGGGCCCGG - Exonic
1181512144 22:23393871-23393893 GGGCCCGGCGGGCAAGAGGCCGG + Intergenic
1181532113 22:23522716-23522738 GGCCGCGGAGGGCGGGGGCCGGG + Intergenic
1181571988 22:23772787-23772809 GGCCGAGGCGGGCCGGGGGTGGG + Intronic
1182401370 22:30080261-30080283 GGGCCGGGCGGGCTAGGGGCCGG + Exonic
1183191193 22:36323028-36323050 GGACGCGGCAGTGGAGGGGCTGG - Intronic
1183408135 22:37640303-37640325 GGACGCTGCAGGCCAGGGGCAGG - Intronic
1183522392 22:38303101-38303123 GGCGGCGGCGGGCGCCGGGTGGG - Intronic
1183601588 22:38843507-38843529 GGACGCGGCGGGCGCTGCGCCGG - Exonic
1183702215 22:39457242-39457264 GACCGCGGCGGGCGCGCGGGGGG - Intergenic
1183720185 22:39557897-39557919 GGGCGCGGGGGGCGGCGGGCGGG - Intergenic
1183880059 22:40819454-40819476 GGCCCCTGTGGGCGCGGGGCGGG + Intergenic
1184034049 22:41910242-41910264 GGCCGGGGCGGGCCGGGGGCGGG + Intronic
1184086900 22:42270695-42270717 GGCCGCGGCGCGCGGGCGGGCGG + Intronic
1184089230 22:42283681-42283703 GGCCGCGCCGGGCCAGGGCAGGG - Intronic
1184101483 22:42343682-42343704 CGCCGCGCCGGGTGGGGGGCGGG + Intergenic
1184153052 22:42649431-42649453 GGGCGGGGCGGGCGCGGGGGCGG + Intronic
1184222616 22:43110661-43110683 GGCCGCTCCCGGGGAGGGGCGGG + Intergenic
1184412230 22:44331876-44331898 GGCGGCGGCGGGCGCGGCGCGGG - Intergenic
1184439197 22:44498239-44498261 GGCCGGGGCAGGGGCGGGGCCGG + Exonic
1184445307 22:44543763-44543785 GGCGGGGGCGGGCGGGGGGCGGG + Intergenic
1184557457 22:45240964-45240986 GGCCGGGGCGGGGAAGGGGCGGG - Intergenic
1184561956 22:45268647-45268669 AGATGGGGCGGGCGAGGGGCGGG - Intergenic
1184688597 22:46107465-46107487 GGCCCAGGCGGGGGAGGGGCCGG - Intronic
1185055203 22:48575678-48575700 GGCCGCGGCGGCGGAGGCGCGGG + Intronic
1185055257 22:48575853-48575875 CGCCGCGGCGGGCCAGGCTCGGG - Intronic
1185081891 22:48714062-48714084 GGCCGCCCTGGGCGAGGGCCTGG - Intronic
1185177146 22:49334410-49334432 GGTGGCGGAGGGCGGGGGGCGGG - Intergenic
1185242750 22:49755323-49755345 GGCTGCAGCGGGGGTGGGGCAGG - Intergenic
1185313841 22:50170488-50170510 GCGCGCGGCGGGTGCGGGGCTGG - Intergenic
1185420327 22:50731317-50731339 GGCCGGGGCGGGAGTGGGGGTGG - Intergenic
949104971 3:192771-192793 GGCCGAGGCGGGAGAATGGCGGG + Intergenic
949129569 3:483619-483641 GGCGGGGGGGGGCGCGGGGCAGG + Intergenic
950097416 3:10338119-10338141 GGCCGGGGCGGGCCAGGGGATGG - Intronic
950400963 3:12768915-12768937 GGCCGGGGCCGGGGCGGGGCGGG + Intronic
950438468 3:12994114-12994136 GGCCGCGCCGGCCGCGGGGACGG - Intronic
950617681 3:14175120-14175142 GGACACAGCGAGCGAGGGGCTGG - Intronic
950650216 3:14402545-14402567 GGCCGGGCCGGGGGCGGGGCCGG - Intergenic
950729927 3:14948072-14948094 GGCCGCGGGCGGGGAGGGGAGGG - Intronic
950829530 3:15859968-15859990 GGCCGCGGCTCGGGCGGGGCGGG + Intergenic
951981993 3:28576066-28576088 GGCCGGGGTGCGCGAGGAGCGGG - Intergenic
952287333 3:31981383-31981405 GGCCGCGGCGGGAGGAGGGGCGG - Intronic
952347609 3:32502886-32502908 GGGCGGGGCGGGCCAAGGGCGGG - Exonic
952744453 3:36764226-36764248 GGCGGCGGCGGCTGCGGGGCTGG + Intergenic
952942279 3:38454046-38454068 GGCGGCGGCGGGGCACGGGCCGG - Exonic
953748707 3:45594067-45594089 GGAGGGGGCGGCCGAGGGGCGGG - Intronic
953930922 3:47005317-47005339 GGCCGGTGCGGCCCAGGGGCTGG + Exonic
954004016 3:47578313-47578335 GGCCGGGGCGGGGCCGGGGCGGG - Intronic
954152311 3:48663606-48663628 GGTCGTGACGGACGAGGGGCGGG - Intergenic
954313211 3:49786282-49786304 GGCGGTGGCGGGCGCGGGGTTGG - Intronic
954540694 3:51391486-51391508 GGCGGAGGCGGGCGGGCGGCGGG + Exonic
954707462 3:52488723-52488745 GCCCGGGGGGGGCGAGGGGCAGG - Intronic
954912678 3:54122366-54122388 GGCCGCGGCGGGAGGGCGGCGGG - Intergenic
956659491 3:71583814-71583836 GGCGGCGGCGGCAGAGGCGCGGG + Intronic
956678188 3:71754298-71754320 GGCCGCGGCGGGGGCGCCGCCGG + Exonic
958026673 3:88058453-88058475 GGCGGGGGCGGGGGAGAGGCGGG + Intronic
958026892 3:88059273-88059295 GGCGGCGGCGGCGCAGGGGCTGG + Exonic
959398372 3:105869054-105869076 GGGCGGGGCGGGGGCGGGGCCGG + Intronic
960101334 3:113746252-113746274 CGCGCCGGCGCGCGAGGGGCGGG - Exonic
960876508 3:122300949-122300971 GGCCAAGGCAGGCGGGGGGCAGG - Intergenic
960914365 3:122681191-122681213 GGCCGGGGCGGGGGCGGGGGCGG + Intronic
960966719 3:123110751-123110773 AGCCGCGGCAGGCCAGGAGCTGG - Intronic
961213369 3:125142097-125142119 GGCCGCGTCTGGCGAGGTACAGG - Intronic
961322275 3:126084107-126084129 GGCGGCGGCGGGAAAGAGGCGGG + Exonic
961446216 3:126983002-126983024 GGGCGGGGCGGGGGCGGGGCCGG - Intergenic
961734671 3:128993921-128993943 GGCTGCGGCGGCCGAGGTGGGGG + Intronic
961827162 3:129605273-129605295 GGCGGCGGCGGGGGCGGGGGCGG - Intronic
961827406 3:129606348-129606370 GGCCGAGGCGGCCGTGGGCCCGG - Exonic
961827519 3:129606711-129606733 GGCGGCGGGAGGCGGGGGGCGGG + Exonic
962164830 3:133038297-133038319 GGCCGGGGCGGGCCAGAGCCTGG + Intergenic
962277953 3:134030033-134030055 GGCGGCGGCGGCGGCGGGGCGGG - Exonic
962808951 3:138945978-138946000 GGCCGCTGTGGTCAAGGGGCTGG - Exonic
963038382 3:141051400-141051422 GGCGGCGGCGGAGGAGGGGGAGG + Exonic
963044891 3:141095118-141095140 GGCCGAGGCAGGCCAGGGGTAGG + Intronic
963061862 3:141232262-141232284 GGCTGCGGGGGGCGAGGGCTTGG - Intronic
963607121 3:147421122-147421144 GGCTGGGGCGGGAGAGGGTCGGG + Intronic
964219118 3:154324280-154324302 GGCGGCGGCGGCGGAGGGGGTGG - Exonic
964569212 3:158094500-158094522 GGCCGCGGCGGGAGCGCGGTAGG - Intergenic
964622732 3:158732677-158732699 GGCCGCGGCGGGAGAGGGTCGGG + Exonic
966712037 3:182980734-182980756 GGGCGCGGCGGGGGAGGGGCGGG + Intronic
966806979 3:183815410-183815432 GGCCAGGGGGGGTGAGGGGCTGG + Intergenic
966874675 3:184315178-184315200 GGCGGCGGCCGTCGAGGAGCCGG - Intronic
967802543 3:193679130-193679152 GGGCGTGGGGGGCGAGGGGAGGG + Intronic
967849470 3:194071120-194071142 AGACGCGGCGGGCGCGGGGGCGG + Intergenic
967859593 3:194141281-194141303 CGCCCCGGCGGGCGCGCGGCGGG - Intergenic
968051244 3:195656438-195656460 GGCTGCTGCGGCTGAGGGGCTGG + Intergenic
968090568 3:195895971-195895993 GGCCGCGGGGGCCTCGGGGCGGG - Intronic
968114980 3:196082252-196082274 GGGCGCTGCGGGCGAGGCGAAGG + Intergenic
968230582 3:197002873-197002895 GGCGGCGGCGGGAGGGAGGCCGG - Exonic
968258190 3:197297998-197298020 GGCCGCGGCGAGCGAGGAGGCGG - Intronic
968457125 4:705628-705650 AGCCGCGGGGCGCGAGGGCCAGG - Intergenic
968514738 4:1011399-1011421 GGCGGGGGCGGGGGCGGGGCCGG + Intronic
968671758 4:1855889-1855911 GGCGGCGGCGGGAGGCGGGCGGG + Exonic
968701059 4:2058653-2058675 GGCCGCGGGGGGCGGGGGCCGGG + Intergenic
968702647 4:2064180-2064202 GGCCGCGCCGGGCGGCGGGCAGG - Exonic
968831531 4:2934757-2934779 AGCCGCGGCAGGTGCGGGGCGGG - Intronic
968874057 4:3255973-3255995 GGCGGCGGCGGCGGCGGGGCCGG + Exonic
968965274 4:3766327-3766349 GGCTGCGGGGGGAGGGGGGCAGG - Intronic
969285701 4:6200664-6200686 GGCGGGGGCGGGGGCGGGGCGGG - Intergenic
969295658 4:6269587-6269609 GGGCGGGGCGGGGGCGGGGCCGG + Intergenic
969344730 4:6563627-6563649 GGGCGCGGCGGGCGCGGCGGGGG + Intergenic
970202863 4:13627463-13627485 GGCCCCGGCGCGGGCGGGGCGGG - Exonic
970202895 4:13627526-13627548 GGCTGCGGCGGGGGAGGCGGCGG + Exonic
970397217 4:15681321-15681343 GGCTGGGGCGGGCGCGGGCCGGG + Intronic
970456306 4:16226827-16226849 GGCGGCGGCGGGCGGCGGGTCGG + Intronic
970585705 4:17512163-17512185 GGCAGCAGCGGGCGCGGAGCGGG - Exonic
971352011 4:25863174-25863196 GGTGGCGGCGGCCAAGGGGCGGG - Intronic
971409957 4:26359696-26359718 GGCCGGGGCGGGCGTGGCGTGGG + Intronic
971457931 4:26861319-26861341 CGCCGCGGCGGGAGAGGAGGCGG - Exonic
972321653 4:37977637-37977659 CGCGGCGGGGGGCGAGCGGCGGG + Intronic
972960650 4:44448425-44448447 GGCGGCGGCGGCCGACGCGCCGG + Exonic
973279220 4:48341716-48341738 GGCGGCGGCGGCGGCGGGGCCGG + Exonic
973981828 4:56314312-56314334 GGAGGAGGAGGGCGAGGGGCAGG + Exonic
974626543 4:64433316-64433338 GGCTGGGGAGGGGGAGGGGCAGG + Intergenic
975166945 4:71187457-71187479 GGCGGAGGCGGGCGCGGGCCCGG + Intronic
975801069 4:78059116-78059138 GGCGGCGGCGGGCGCAGGGCGGG + Intronic
975870833 4:78776580-78776602 GGCAGCGGCGGCGGAGCGGCGGG + Exonic
975983450 4:80183766-80183788 GCCCCAGGCGGGCGCGGGGCAGG - Intergenic
976226333 4:82798067-82798089 GACCGCGGCGGGGTGGGGGCGGG + Intronic
977574002 4:98658403-98658425 GGCCTCGGCGCGCGAGGGGCTGG - Exonic
977694337 4:99949908-99949930 GGCCGTGGCGAGCGCGCGGCGGG - Intronic
978072592 4:104491465-104491487 GGCAGCGGCGGGGGCGGGGGCGG - Exonic
978443971 4:108763113-108763135 GGCCCCGGCGGGGGAGGAGGAGG - Intergenic
979455640 4:120922844-120922866 GGGCGCGGGGGGCGCGGGCCTGG + Exonic
979547110 4:121951406-121951428 GGCGGTGCCGGGCGGGGGGCGGG - Intronic
980130015 4:128809785-128809807 GGCCGCGGCGGGCGGGGAGCCGG - Exonic
981745636 4:148049835-148049857 GGGGGCGGGGGGCGGGGGGCGGG + Intronic
981885566 4:149668509-149668531 GGCAGCGGGGGGCAAGGGGAGGG + Intergenic
982042369 4:151409036-151409058 GGCGGCGGCGGGGGCGGGGCCGG + Intergenic
982042389 4:151409099-151409121 GGCCGGGGCGGGGCAGGGGCGGG - Intergenic
982292115 4:153790937-153790959 GGCCGGGGCCGGCGGGGGGTTGG - Intergenic
982712264 4:158769170-158769192 GGCCGTGGCGCTCGGGGGGCCGG - Exonic
983577181 4:169271503-169271525 AGTCGCGGCGCGGGAGGGGCTGG + Intergenic
984928254 4:184825646-184825668 GGGCGGCGCGGGCGCGGGGCTGG - Intronic
984991388 4:185384895-185384917 GGCGGCGGGGGACGGGGGGCGGG - Intronic
985541308 5:488882-488904 GGGCGCGGCCAGGGAGGGGCAGG + Intronic
985675141 5:1227068-1227090 GGCGTCGGCGGGCAAGGGGTCGG - Intronic
985781111 5:1872339-1872361 GGCCACGGGGGGCGGGGGGGTGG - Intergenic
986608619 5:9546167-9546189 GGCGGGGGCGGGGCAGGGGCGGG - Intergenic
986608623 5:9546173-9546195 CGCGGCGGCGGGGGCGGGGCAGG - Intergenic
986693740 5:10333965-10333987 GGCAGCGGCGACCCAGGGGCTGG + Intergenic
987050806 5:14144914-14144936 GGCGGCGGCGGCCTCGGGGCCGG + Intronic
987051962 5:14154335-14154357 GGCCGGGGAGTGAGAGGGGCAGG + Intronic
989178873 5:38556704-38556726 GGCAGGGGCGGGTCAGGGGCGGG - Intronic
989261660 5:39425198-39425220 GACCGACGCGGGCGGGGGGCGGG + Intronic
989812611 5:45695997-45696019 GTCCGCGACGGGCGCGGGGCCGG - Exonic
989983130 5:50666745-50666767 GGCCGTGGGGGCCGAGGTGCCGG - Intronic
990382929 5:55233482-55233504 GGCGGCGGGGCTCGAGGGGCTGG + Exonic
991216827 5:64165731-64165753 GGCTGTGGCGGGCGAGCGCCGGG + Intergenic
991590311 5:68244513-68244535 GGCGGCGGGGGGCGGGGGGGCGG - Intronic
991743793 5:69710597-69710619 GGGGGCGGGGGGCGGGGGGCGGG + Intergenic
991743797 5:69710604-69710626 GGGGGCGGGGGGCGGGGGGCAGG + Intergenic
991753916 5:69844638-69844660 GGGGGCGGGGGGCGGGGGGCAGG - Intergenic
991795365 5:70290329-70290351 GGGGGCGGGGGGCGGGGGGCGGG + Intergenic
991795369 5:70290336-70290358 GGGGGCGGGGGGCGGGGGGCAGG + Intergenic
991803541 5:70401393-70401415 GGGGGCGGGGGGCGGGGGGCAGG - Intergenic
991823164 5:70585872-70585894 GGGGGCGGGGGGCGGGGGGCAGG + Intergenic
991833228 5:70719751-70719773 GGGGGCGGGGGGCGGGGGGCAGG - Intergenic
991833232 5:70719758-70719780 GGGGGCGGGGGGCGGGGGGCGGG - Intergenic
991887732 5:71289848-71289870 GGGGGCGGGGGGCGGGGGGCGGG + Intergenic
991887736 5:71289855-71289877 GGGGGCGGGGGGCGGGGGGCAGG + Intergenic
992905862 5:81345112-81345134 GGCAGCGGTGGGCGAGGAGGTGG - Intronic
992940586 5:81757385-81757407 GGCCGGGGCGGGCCAAGGTCTGG + Intergenic
993168385 5:84384662-84384684 AGGCGCGGCGGGCGGGGCGCGGG + Exonic
993463643 5:88217563-88217585 GGCAGCGGTGGGCGAGGGGGTGG + Intronic
994072737 5:95620480-95620502 GGCGGCGGCGGGCCCTGGGCGGG + Exonic
994353240 5:98769666-98769688 GGACGTGGGGGGCGAGCGGCAGG + Intronic
995142294 5:108748461-108748483 GGCCGCGGCCGGGAAGTGGCCGG - Intronic
995209012 5:109515626-109515648 GGCGGTGGGGGGCGGGGGGCAGG + Intergenic
995975843 5:118034047-118034069 GGGCGAGGCGGGCGAGGCACCGG - Intergenic
996252085 5:121348016-121348038 GGCCGTGGGGGGCAAGGGGAGGG - Intergenic
997265000 5:132490356-132490378 GGCCGCGGCGCGGGGAGGGCGGG - Intronic
997584093 5:135034444-135034466 GGCCGCGGGGGGCGGGGAGGCGG - Intronic
997596954 5:135113470-135113492 GGCAGAGGCGGGCAGGGGGCTGG - Intronic
997659594 5:135579125-135579147 TCCCGGGGCGGGCGACGGGCGGG - Exonic
998018841 5:138753371-138753393 GGGGGCCGCGGGCGGGGGGCGGG + Intronic
998133976 5:139665163-139665185 GGCAGCGTCAGGCGAGGAGCTGG - Intronic
998409247 5:141896615-141896637 GGGCGCGGCGGGTGACGGGACGG + Intergenic
999281577 5:150369734-150369756 GGCTGCAGCCGGAGAGGGGCAGG + Intronic
999300376 5:150486594-150486616 GGCCGCGCGGGGCCGGGGGCAGG + Intronic
999654913 5:153801950-153801972 GGCGGGGGGGGGCGGGGGGCAGG + Intronic
999767929 5:154755281-154755303 CGACGCGGCGGGCGAGGGGAGGG - Intronic
999768170 5:154756040-154756062 GGCGGCGGCGAGCCAGGCGCTGG + Intronic
1002046284 5:176543344-176543366 GGCCGCGGCAGGCGGCGCGCGGG - Intronic
1002061941 5:176630351-176630373 GGCCGGGGTGGACCAGGGGCCGG + Exonic
1002105593 5:176878134-176878156 AGCGGCGGGGGGTGAGGGGCGGG - Intronic
1002190026 5:177473264-177473286 GTGCGCGCCGGGGGAGGGGCCGG - Intronic
1002197628 5:177509858-177509880 GGGCGGGACGGGGGAGGGGCGGG - Intronic
1002376792 5:178794784-178794806 GGCTGCGGCAGGCGGGAGGCAGG - Intergenic
1002559555 5:180072030-180072052 GGACGCGGCGGGGGAGGGGAAGG + Exonic
1002759416 6:190222-190244 GGCCTCAGAGGGCTAGGGGCTGG - Intergenic
1002991868 6:2245732-2245754 GGCCACCGCGCGGGAGGGGCGGG + Intergenic
1003049195 6:2765191-2765213 TGCGGGGGCGGGGGAGGGGCGGG - Intergenic
1003049293 6:2765588-2765610 GGCCGCGCCGGGCGCCGGGGAGG + Exonic
1003093363 6:3122668-3122690 GGCCAAGGCGGGTGAGTGGCAGG + Intronic
1003139173 6:3456800-3456822 AGCCGCGGCGGCTGAGGGCCCGG - Intronic
1003290659 6:4776228-4776250 GGCCGAGGCGGGCGGCCGGCGGG - Intronic
1003325097 6:5085207-5085229 GCCCGCGACGGGGGAGGGCCGGG - Exonic
1003345195 6:5260601-5260623 GGGGGCGGGGGGCCAGGGGCCGG - Intronic
1004193970 6:13487705-13487727 GGCGGCGGCGGGGGCGGGGGCGG - Intergenic
1004241344 6:13925037-13925059 GCCCGCGGCCGGGGAGGGGTCGG + Intronic
1004607255 6:17206387-17206409 GGCCGCGGGGGGAGGGGAGCAGG + Intergenic
1004690349 6:17987698-17987720 GGCGGCGGCGGGCGGGGAGGAGG + Intergenic
1005040275 6:21594956-21594978 GGAGGCGGCGGCCGAGGAGCTGG - Exonic
1005512121 6:26520853-26520875 GGCGGGGGCGTGGGAGGGGCGGG - Intergenic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1006170202 6:32087898-32087920 GGCCGTGGGGGCCGCGGGGCTGG + Intronic
1006337521 6:33428174-33428196 GGGCGCCGCGCGCGTGGGGCGGG + Intronic
1006362197 6:33592917-33592939 GGCTGCCGCAGGCGTGGGGCGGG + Intergenic
1006366907 6:33621362-33621384 GGGCGGGGCGGGCGGGCGGCGGG + Exonic
1006369214 6:33633812-33633834 GGGCGGGGCGGGCGCGGGGCGGG + Intronic
1006369219 6:33633823-33633845 GCGCGGGGCGGGCGCGGGGCGGG + Intronic
1006400170 6:33813097-33813119 GGGGGCGGGGGGCGGGGGGCGGG + Intergenic
1006671440 6:35731947-35731969 GGGCGCGGCGGGAGTGGGGGAGG + Intergenic
1006752567 6:36387816-36387838 CGCCGCTGCGGGCTAGGAGCAGG + Intergenic
1007226952 6:40321800-40321822 GGCGGCGGCGGGCGTGGGGATGG - Intergenic
1007479023 6:42137808-42137830 GGCAGGGGCGGGGGCGGGGCGGG + Intronic
1007557817 6:42782014-42782036 GGCGGCGGCGGGCGCGGGGCCGG - Exonic
1007739144 6:44000515-44000537 CGCCGCGGCAGGCCAGGGGAGGG + Intergenic
1007800507 6:44388147-44388169 GGCCGGGGGGGGCGGGGGGGCGG - Intronic
1008378688 6:50819878-50819900 GGCCGAGGCGGGCGAGGCGCGGG + Intronic
1008630499 6:53359411-53359433 GCCCGCCGAGGGCGCGGGGCGGG - Intergenic
1011272523 6:85593876-85593898 CGCGGCGGGGGGCGTGGGGCTGG - Exonic
1011416255 6:87122776-87122798 GGCGGCGGCGGGCCTGGGGCCGG + Intergenic
1011734173 6:90296048-90296070 GGCCTCGCCGGGCCGGGGGCAGG + Intronic
1011762782 6:90586706-90586728 GGCAGAGGCGGGGGCGGGGCAGG + Intronic
1012410131 6:98947649-98947671 GGCCGCGGGCGGGGAGGGGCGGG + Intronic
1013619422 6:111873333-111873355 GGCTGCCGCGGGCGAGGAGGAGG - Exonic
1013793635 6:113860243-113860265 GGCGGCAGCGGGCGAGGAGGGGG + Exonic
1014137732 6:117907906-117907928 GGCGGCGCCGGGCGAGGGCGCGG + Intronic
1014246827 6:119078540-119078562 GGCGGCGGCGGCCGGGGGCCGGG + Exonic
1015376112 6:132512724-132512746 GACCGCGGCGGGTGCGTGGCTGG + Intronic
1015773472 6:136792031-136792053 GGCGGCGGTGGGCGAGGGCGAGG - Exonic
1016340818 6:143060475-143060497 CGCCGGGCCGGGCGAGGGGGCGG - Intronic
1016738551 6:147506824-147506846 GGCGGCGGCCCGCGCGGGGCGGG + Intergenic
1016923446 6:149317815-149317837 GGCGGCGGCGGGCGAGCGGAGGG + Intronic
1016923497 6:149317969-149317991 GGCGGCGGCGGCCGAGGAGGAGG + Intronic
1017164200 6:151391729-151391751 GGCGGAGGCGGGCGGGGGGAGGG - Intergenic
1017842427 6:158232436-158232458 GGGCGCGGCGGGCGGGGGTCGGG + Intronic
1017889109 6:158624769-158624791 CGCCCCTGGGGGCGAGGGGCTGG - Intronic
1018013606 6:159693347-159693369 GGGCGCGGCGGGCGCGGGGCGGG - Intronic
1018017866 6:159727772-159727794 GCCCCCGGCGGGTAAGGGGCGGG + Intronic
1018020951 6:159761966-159761988 GGAGGTGGAGGGCGAGGGGCGGG + Exonic
1018778996 6:167045351-167045373 GGCCGCGGGGGGGGCGGGGAGGG - Exonic
1018942604 6:168319460-168319482 GGGCGCGGCGGGCGCGGGCGGGG + Exonic
1019112037 6:169724329-169724351 GGCTGAGGCGAGCGAGTGGCGGG - Intronic
1019112042 6:169724351-169724373 GGCTGAGGCGAGCGAGCGGCGGG - Intronic
1019345813 7:530297-530319 GGCAGCGCCGGGCGAGGGCTTGG - Intergenic
1019442527 7:1054679-1054701 GGGTGCGGCGGGCAAGAGGCTGG + Intronic
1019453064 7:1109699-1109721 GGGCCCGGCGGGGGAGGGGAAGG - Intronic
1019472806 7:1230211-1230233 GGCGGGGGCGGGGGAGGGGCGGG + Intergenic
1019473386 7:1232943-1232965 GGCCGGGGCGGGCCAGCGGCGGG - Exonic
1019476741 7:1247923-1247945 GACGGCTGCGGGGGAGGGGCGGG - Intergenic
1019549717 7:1595932-1595954 GGCAGCGGCGGGTGAGGGAAGGG - Intergenic
1019726311 7:2604811-2604833 GGCAACGGCGGGCGAGAGGGAGG - Intronic
1019925794 7:4191192-4191214 GACTGCGGCGGGGGAGGGCCTGG - Intronic
1019925813 7:4191237-4191259 GACCGCGGCGGGGGAGGGCCTGG - Intronic
1020130174 7:5555217-5555239 GGCCGGGCCGGCCGAGGGGCGGG - Intronic
1020137420 7:5594692-5594714 GCGCGCGGCGGGCGAAGGGCGGG - Intronic
1020204676 7:6105266-6105288 GGCCGCGGCGGGCGGGCACCGGG + Intronic
1020274368 7:6615692-6615714 GGCCGGGGCGGGGGCGGGGCGGG - Exonic
1020278311 7:6637521-6637543 GGCGGCGGCGGCGGCGGGGCCGG + Intronic
1021969354 7:25951365-25951387 GGCCGCGCGGGGCTGGGGGCGGG + Intergenic
1022018576 7:26376700-26376722 GGCCGCGCCGGGGCCGGGGCTGG + Intergenic
1022207604 7:28179778-28179800 GGCGGCCGCGGGCGGGGGCCGGG - Intronic
1023638595 7:42237134-42237156 GGCCGCGGGGCGCGCGGGGAAGG + Intronic
1023791677 7:43758328-43758350 GGCCCCGGCGTGGGGGGGGCAGG - Intergenic
1023842219 7:44104203-44104225 GGGGGCGGGGGGCTAGGGGCGGG - Intergenic
1023842227 7:44104217-44104239 GGGGGCGGGGGGCGGGGGGCGGG - Intergenic
1023872325 7:44269684-44269706 GGCGGGGGCGGCGGAGGGGCAGG + Intronic
1023915009 7:44582165-44582187 GGCCTCTGCGGGCGATGGGGCGG - Exonic
1024043810 7:45574434-45574456 GGCGGCGGGCGGCGAGGCGCCGG - Intronic
1024043814 7:45574448-45574470 CGCCGGGGCGGGCGGGCGGCGGG - Intronic
1024471823 7:49774041-49774063 AGCAGCGGCGGGCGCGGGCCCGG - Exonic
1025639039 7:63350039-63350061 GGCCACGGCGGGCGGGAGGCGGG + Intergenic
1025643660 7:63398053-63398075 GGCCACGGCGGGCGGGAGGCGGG - Intergenic
1025713252 7:63931087-63931109 GGCCACGGCGGGCGGGAGGCGGG - Intergenic
1025813388 7:64889289-64889311 GGCACCGGCGGGCGAGAGCCTGG - Intronic
1026360263 7:69597461-69597483 GGCGGCCGCGGGCGAGGGGCGGG - Intergenic
1026360547 7:69598415-69598437 GGCCGCGGAGGGGGAGGAGCGGG + Intergenic
1026458890 7:70596168-70596190 GGCCGGGGCGGGGCTGGGGCGGG + Intronic
1026765163 7:73155454-73155476 AGCGGCGGCGGGGGCGGGGCGGG - Intergenic
1026828196 7:73596722-73596744 GGCCGGGGCGGTGTAGGGGCCGG + Exonic
1026968097 7:74453244-74453266 GAGCGGGGCGGGCGGGGGGCGGG + Intergenic
1027041636 7:74965209-74965231 AGCGGCGGCGGGGGCGGGGCGGG - Intronic
1027082006 7:75237160-75237182 AGCGGCGGCGGGGGCGGGGCGGG + Intergenic
1027108372 7:75419482-75419504 GGCGGAGGCAGGCGAGGAGCCGG + Intronic
1027218894 7:76201823-76201845 GGGCGCTGCGGGCGCGGGGCTGG + Intergenic
1028762326 7:94509886-94509908 GGCCGCGGCCGAGGAGGGGCAGG + Exonic
1029123244 7:98281895-98281917 GGCGGCGGCGGGGGCGCGGCGGG - Exonic
1029390589 7:100271705-100271727 AGCGGCGGCGGGGGCGGGGCGGG + Intronic
1029461079 7:100694148-100694170 GCGCGCGGCGGGCGGGGGCCGGG + Intergenic
1029501923 7:100936613-100936635 GGCCGAGGCGGGCGGAGGTCAGG - Intergenic
1029640461 7:101816527-101816549 GGCGGCGGCGGGCGCCGGGAGGG + Intronic
1029708331 7:102286812-102286834 GGCGGGGGCGGGGGCGGGGCGGG + Intronic
1029730129 7:102433492-102433514 GGCTGCGGCGGCCGCGGGGGCGG + Intronic
1030033463 7:105388976-105388998 GGGCGGGGCGGGGGCGGGGCCGG - Intronic
1030121220 7:106112333-106112355 GGCCCGGGCGGCCGTGGGGCGGG + Intronic
1031162437 7:118184268-118184290 GGCCGCCGCGGGCGTGAGCCGGG + Intronic
1031886769 7:127252465-127252487 GGCACCAGGGGGCGAGGGGCTGG - Intronic
1032021554 7:128409656-128409678 CGACGCTGCGGGGGAGGGGCAGG - Intronic
1032240007 7:130153257-130153279 GGCTCCGGCGGGGAAGGGGCTGG + Intergenic
1033099693 7:138460110-138460132 GGCCGCGCCTGGCGAGGGGGCGG - Intergenic
1033654374 7:143362821-143362843 CGCCGCGGCCGGGGAGGGGGCGG + Intergenic
1034420636 7:150988920-150988942 GGGAGCAGCGGGAGAGGGGCGGG - Intergenic
1034446085 7:151115013-151115035 GGCCCCGGCGGCCGAGGCGCGGG - Intronic
1034456543 7:151174030-151174052 GGTCGCGGCGGGCGAGATTCGGG - Intronic
1034483544 7:151341743-151341765 AGCGGCGGCGGGGGCGGGGCTGG + Exonic
1034560364 7:151876222-151876244 GGGCGCGGCGGGTGGGCGGCTGG - Intronic
1034560619 7:151877316-151877338 CGCGGCGGGGGGCGAGGAGCGGG - Intergenic
1034617938 7:152435535-152435557 GGGCGCGGAGGCCGCGGGGCGGG + Intronic
1034618254 7:152436590-152436612 AGCGGCGGCGCGCGGGGGGCGGG - Intergenic
1034967070 7:155398236-155398258 GGAGGCGGGGGGCGGGGGGCGGG + Intergenic
1034998651 7:155594241-155594263 GGCCTCGGCGTGGGAAGGGCAGG - Intergenic
1035023217 7:155810641-155810663 GGCCGAGAAAGGCGAGGGGCAGG - Intronic
1035153401 7:156893211-156893233 GGGCGGGGCGGGGGCGGGGCAGG + Exonic
1035167340 7:156999785-156999807 GGCCGGGGCGGGCCGGGGTCAGG - Intronic
1035949168 8:4000097-4000119 GCCCACGGAGGGCGGGGGGCAGG - Intronic
1035949188 8:4000227-4000249 GTCCACGGAGGGCGGGGGGCAGG - Intronic
1036390300 8:8318874-8318896 GGCGGGGGCGGGCCCGGGGCCGG + Exonic
1036664681 8:10730722-10730744 GGCCCTGGCGGCGGAGGGGCGGG - Intronic
1036683558 8:10893574-10893596 GGCCACGGCTGGGGAGGGACTGG + Intergenic
1036708037 8:11059617-11059639 GGGCGCGGGGGGCGCGGGGCGGG + Intronic
1036708060 8:11059672-11059694 AGGTGCGGCGGGCGCGGGGCGGG + Intronic
1036733269 8:11284686-11284708 GGCCGCGGGGAGACAGGGGCTGG - Exonic
1036788657 8:11703850-11703872 CGCAGCGGCGGGCGAGGGGCGGG - Intronic
1037262894 8:17027489-17027511 GGCGGCGGCCGGCGGGGGGCTGG + Exonic
1037313136 8:17577169-17577191 GGAGGCGGCGGGCGAGGGGCGGG - Exonic
1037886831 8:22599852-22599874 GCCCGCGGGGTGCGCGGGGCTGG - Intronic
1038205052 8:25458159-25458181 GGGCGCGGCGGGCCGGGGGTCGG - Intronic
1038540342 8:28385856-28385878 GGCCGCGGCGGGCGGGGCGCGGG - Intronic
1038828551 8:31033181-31033203 GGCGGCGGCGGGGGAGGAGGCGG - Exonic
1038883666 8:31640290-31640312 GGCGGCGGCGGGCGAGGCAGGGG + Intronic
1039454281 8:37697240-37697262 GGCGGCGGCGGCCAACGGGCTGG + Exonic
1039527802 8:38231864-38231886 GACCGCGTCGGGCGGGCGGCTGG + Intronic
1039542301 8:38382235-38382257 GGCGGCGGCGGGAGAGGCGGCGG - Exonic
1039864728 8:41490745-41490767 GGCGGGTGGGGGCGAGGGGCTGG + Exonic
1039903109 8:41767100-41767122 GGCTGCGGCCGCGGAGGGGCTGG - Intronic
1040928906 8:52714213-52714235 GGCCGCGGCGGGCGGGCGCCCGG - Exonic
1041068181 8:54102000-54102022 AGGGGCGGCGGGCGAGGGGCAGG - Exonic
1041552845 8:59119814-59119836 GGCCGGGGAGGGCCGGGGGCGGG - Intergenic
1041650795 8:60300381-60300403 GGGGGCGGGGGGCGAGGGGGTGG - Intergenic
1042082615 8:65071548-65071570 GGGCGCGGGGGGCGGGGGGAGGG + Intergenic
1042216325 8:66432418-66432440 GGCAGGCGCGGCCGAGGGGCGGG + Intronic
1042785091 8:72537375-72537397 GGCGGCGGCGGCCGCGGGGGCGG - Exonic
1043885224 8:85591639-85591661 GGGAGGGGCGGGGGAGGGGCAGG - Intergenic
1044306466 8:90645935-90645957 GGGCGCCGCGGCGGAGGGGCTGG - Exonic
1044335981 8:90985242-90985264 GGCGGCGGGGGGCGAGGGGCGGG + Exonic
1044335989 8:90985256-90985278 AGGGGCGGGGGGCGAGGGGCGGG + Exonic
1044973642 8:97643874-97643896 GGCGGGGGCGGGCGGGGGGCGGG - Intergenic
1045098771 8:98825457-98825479 GGCGCCGGCGGCCGCGGGGCGGG - Intronic
1045184153 8:99818961-99818983 GGGGGCGGCGGGGGAGGGGTGGG + Intronic
1045516291 8:102863621-102863643 GGCGGCGGCGGCGGCGGGGCTGG - Intronic
1046094366 8:109539898-109539920 GGGCGGGGAGGGGGAGGGGCAGG + Intronic
1047100160 8:121667531-121667553 GCCCCCGGCGGGGGCGGGGCGGG + Intergenic
1047258316 8:123233621-123233643 GGCCGAGGTGGGCGAAGGTCAGG - Intronic
1048553906 8:135457371-135457393 CGGGGCGGCGGGCGCGGGGCGGG + Intergenic
1049198034 8:141326086-141326108 GGCCAGGGAGGGCGAGGGGCCGG + Intergenic
1049214568 8:141401868-141401890 GGCCACAGCGGGGGAGGGGTAGG - Intronic
1049217733 8:141415612-141415634 GTGCGCGGAGGGCGGGGGGCAGG + Intronic
1049390560 8:142367512-142367534 CGCCGGGGCGGGGGAGGGGGAGG + Intronic
1049405321 8:142449718-142449740 GGCGGCGGCGGGCGCGGCGTTGG + Exonic
1049470752 8:142774116-142774138 TCCCGCTGCGGGGGAGGGGCTGG + Intronic
1049471587 8:142777304-142777326 GGCCGGGGCAGGCCTGGGGCGGG - Intronic
1049474542 8:142790617-142790639 GGCCGGGCCGGGCCAGGGGCCGG + Intergenic
1049651368 8:143771393-143771415 GGCGGGGGCGGGGGCGGGGCCGG + Intergenic
1049689784 8:143953443-143953465 GGCGGCGGCGGCGGCGGGGCGGG - Intronic
1049693680 8:143973567-143973589 GGGCGGGGCGGGGGCGGGGCGGG - Intronic
1049762278 8:144336909-144336931 GGCGGCGGCGGGCGGGGGGCGGG + Intergenic
1049773268 8:144393417-144393439 GGGCGGGGCGCGCGGGGGGCGGG + Intronic
1049774423 8:144397899-144397921 CTCAGCGGCGGGCAAGGGGCAGG + Intronic
1049784651 8:144444568-144444590 CGCCGCCGCCGTCGAGGGGCGGG - Intergenic
1049788560 8:144462725-144462747 GGCGGCGGCAGGAGAGCGGCGGG - Intronic
1049798044 8:144505506-144505528 GGGCGCGGGGGGAGTGGGGCGGG - Intronic
1049798061 8:144505548-144505570 GGGCGCGGGGGGAGTGGGGCGGG - Intronic
1049798079 8:144505590-144505612 GGGCGCGGGGGGAGTGGGGCGGG - Intronic
1049798097 8:144505632-144505654 GGGCGCGGGGGGAGTGGGGCGGG - Intronic
1049798115 8:144505674-144505696 GGGCGCGGAGGGAGTGGGGCGGG - Intronic
1050094194 9:2047145-2047167 GGCCCCGGGGGGCGGCGGGCAGG + Intronic
1050151547 9:2622741-2622763 GGACGCGGAGCGCCAGGGGCCGG + Intronic
1050388216 9:5111955-5111977 GCCCACGGCGGTGGAGGGGCTGG - Intronic
1051418783 9:16870714-16870736 GCCAGCGGCGGCCGAGGGGCTGG - Intronic
1051483599 9:17585194-17585216 GGCAGCGGCGAGAGAAGGGCAGG + Intronic
1052362214 9:27573444-27573466 GCCCGCGGCGGCGGAGGCGCAGG - Intronic
1052756801 9:32550632-32550654 GGCCTCGGCGGGCCAGGGCCAGG - Intronic
1053163531 9:35829424-35829446 GCCCGGGGCGGGGGCGGGGCCGG - Intronic
1053240027 9:36487694-36487716 GGCGGCGGCGGCGGAGGGGGCGG + Intergenic
1054489415 9:65762587-65762609 GGCGGCGGCGGGGGGGGGGTGGG - Intergenic
1054790663 9:69253678-69253700 GGCCGAGGCGGGCGGAGGTCAGG - Intronic
1054905923 9:70413627-70413649 GATCGCGGCCGGCGCGGGGCAGG - Exonic
1055318930 9:75063073-75063095 GGCCGAGGCGGGCGGAGGTCAGG + Intronic
1055945527 9:81688711-81688733 GGCGGCGGCGGGCGAGGTGCAGG + Exonic
1056852268 9:90094593-90094615 GACCGGGGTGGGCGGGGGGCGGG + Intergenic
1057355090 9:94325721-94325743 GGCCGCGGCCCGAGTGGGGCCGG - Exonic
1057358022 9:94347659-94347681 AGCCGCGGCGAGCAAGGAGCTGG + Intergenic
1057490634 9:95517034-95517056 GGCCGCGGGGGGCGGGGAGAGGG - Intronic
1057494959 9:95553501-95553523 GGCCGCGGCGGGGCGGCGGCTGG - Intergenic
1057649727 9:96909958-96909980 AGCCGCGGCGAGCAAGGAGCTGG - Intronic
1058023712 9:100117599-100117621 GGGCGGGGGGGGCGGGGGGCCGG - Intronic
1058254863 9:102749221-102749243 GGGGGCGGGGGGCGGGGGGCGGG + Intergenic
1058439271 9:104992094-104992116 GTGCGCGGCGGGCGTGGTGCTGG + Intergenic
1058866656 9:109167183-109167205 GGGCGCCGCGGGCGCGGGCCGGG + Exonic
1058908106 9:109497953-109497975 GGCCGGGGCGGGCTGGCGGCCGG - Intronic
1058908529 9:109499843-109499865 GGCCGGGCCGGGCGGGGCGCGGG - Intergenic
1059102347 9:111483372-111483394 GGCCGCGGCGTACGGGGAGCTGG - Intronic
1059197037 9:112380057-112380079 GGCAGGGGCGGGGCAGGGGCGGG + Exonic
1059230678 9:112718307-112718329 GCCCGGGGCGGGGGAGGGGCGGG + Intergenic
1059375140 9:113875906-113875928 GGGCGCGGGGGGCGCGGGGAGGG + Intergenic
1059942261 9:119369538-119369560 GGGAGCGGCGGCCGGGGGGCGGG + Intergenic
1060106709 9:120877213-120877235 GGTCTCGGCGGGGGCGGGGCGGG + Exonic
1060140039 9:121201709-121201731 GGACGCAGCGGGAGAGGGGGCGG + Exonic
1060302211 9:122381393-122381415 GGAAGCGGCGGGCCAGGAGCTGG - Exonic
1060770173 9:126326812-126326834 GGCGGCGGCGGCGGAGGGGCGGG - Intergenic
1060855799 9:126914557-126914579 GGGCGTGGCGGGCGGCGGGCCGG + Intergenic
1060974314 9:127755389-127755411 GAGGGCGGGGGGCGAGGGGCTGG - Intronic
1060986985 9:127825568-127825590 GGCTGCGGCGGGGCTGGGGCTGG + Intronic
1061075845 9:128340886-128340908 GGCCGAGTCGGGCGAGGTGGCGG + Intronic
1061248425 9:129413388-129413410 GGCCGCGGCGGGCGGGGGCCGGG - Intergenic
1061257401 9:129460628-129460650 GCCCGCGGCGGCCGAGCAGCCGG - Intergenic
1061472123 9:130835203-130835225 GGCGGCGGCGGGGCGGGGGCGGG + Intronic
1061485609 9:130919120-130919142 AGCCACGGCGGGCGCGGGGCTGG + Intronic
1061559581 9:131394037-131394059 GGCGGCGGCAGGCGGGGGGCGGG + Intergenic
1061572490 9:131486307-131486329 TGCCGTGGCGGGCCAGGTGCTGG - Intronic
1061580007 9:131530890-131530912 GGCTGGGGCGGGCGAGGGGTTGG - Intronic
1061961533 9:133991528-133991550 GGCGGAGGCCGGCGAGGGGGCGG + Intronic
1061972345 9:134051531-134051553 AGCTGGGGCAGGCGAGGGGCTGG - Intronic
1062084447 9:134641634-134641656 GGGCGCCGCGGGCGAGGGGGTGG - Intergenic
1062146537 9:134992513-134992535 GTCCGCGGCGGGGGGGGGGGGGG - Intergenic
1062230650 9:135479937-135479959 GGAGGCGGCGGGCCGGGGGCGGG - Exonic
1062230736 9:135480122-135480144 GGCCGCGGCGGGCGGGCGGCGGG + Intronic
1062306003 9:135907425-135907447 GGCGGGGGCGGGCGCGGGGGCGG + Intergenic
1062327433 9:136018967-136018989 GGCAGGGGCTGGGGAGGGGCGGG - Intronic
1062516852 9:136941195-136941217 GGCAGCAGCGGGCGGGCGGCCGG - Intronic
1062533914 9:137013373-137013395 GGGCCAGGCGGGCGAGGGGGCGG - Intronic
1062584188 9:137241595-137241617 GCGCGGGGCGGGGGAGGGGCGGG + Intronic
1062696224 9:137877665-137877687 GGCGGGGGCGGCCGCGGGGCGGG + Intergenic
1203771974 EBV:54100-54122 GGCCGAGGCGGCCGAGGTCCGGG - Intergenic
1185505643 X:630869-630891 GGCCGGGGCTGGCGAGCAGCCGG - Exonic
1185761320 X:2691456-2691478 GGACGCGGAGGGCGCGGGCCGGG + Intronic
1185778768 X:2828723-2828745 GGCCGCGGCGGGCGAGGGGCGGG + Intergenic
1187281597 X:17861423-17861445 GGCGGCGGCGGAGGAGGGACAGG + Intergenic
1187507276 X:19887771-19887793 GGGCGGGGCCGGAGAGGGGCGGG + Intergenic
1187507291 X:19887805-19887827 GGCCGCGTCGGGGCAGGCGCCGG + Intergenic
1188242642 X:27809480-27809502 GGGCGGGGCGGGGGGGGGGCCGG - Intronic
1188242668 X:27809516-27809538 GCCGGCGGCGGGGGGGGGGCGGG - Intronic
1189001998 X:36957668-36957690 GGGCGGAGCGGGCGCGGGGCCGG + Intergenic
1189002790 X:36963740-36963762 GCCCGCGGCGGAGGTGGGGCCGG - Intergenic
1189137113 X:38561499-38561521 GGCGGCGGCAGGCGGCGGGCGGG - Exonic
1189331357 X:40146677-40146699 GGGCGCGGCGGGCGGGGAGGGGG - Intronic
1189332935 X:40154234-40154256 GGGCGAGGAGGGGGAGGGGCGGG - Intronic
1189982158 X:46521637-46521659 GGCCAAGGCGGGGGAGGGGGGGG + Intronic
1190385637 X:49879962-49879984 GGCCGCGCCGGGGCCGGGGCCGG - Exonic
1190542972 X:51496873-51496895 CGCGGCGGAGGGCGAGGGGCGGG + Intergenic
1190714652 X:53093355-53093377 GGCCGGAGCGCGCGAGGGGTGGG + Intergenic
1190714832 X:53094337-53094359 GGCCGAAGCGCGCGAGGGGTGGG + Intergenic
1191184225 X:57592518-57592540 GGCCGCGGCGGGGCCGGGGGCGG - Exonic
1191213168 X:57909941-57909963 GGCCGCGGCGGGGCCGGGGGCGG + Exonic
1191830206 X:65407585-65407607 GGCGGCGGCGGGCGAGGCGCAGG - Intronic
1192179329 X:68906561-68906583 GGCGGCGGGGGTGGAGGGGCAGG - Intergenic
1193450142 X:81655441-81655463 GGGCGGGACGGGGGAGGGGCGGG + Intergenic
1194890422 X:99372046-99372068 GGCCGCGGCGCGGGACTGGCAGG - Intergenic
1195269484 X:103215598-103215620 GGGCGGGGCGGGGGAGGGGCCGG + Intronic
1196684069 X:118495886-118495908 GGCCGCGGCCGCCGCGGGCCGGG + Intronic
1196951730 X:120931484-120931506 AGCCCGGGCGGGCGAGGGCCTGG - Exonic
1196952414 X:120936345-120936367 AGCCCGGGCGGGCGAGGGCCTGG - Exonic
1196953099 X:120941206-120941228 AGCCCGGGCGGGCGAGGGCCTGG - Exonic
1196953784 X:120946066-120946088 AGCCCGGGCGGGCGAGGGCCTGG - Exonic
1196954469 X:120950927-120950949 AGCCCGGGCGGGCGAGGGCCTGG - Exonic
1196955152 X:120955787-120955809 AGCCCGGGCGGGCGAGGGCCTGG - Exonic
1196955839 X:120960670-120960692 AGCCCGGGCGGGCGAGGGCCTGG - Exonic
1196956521 X:120965531-120965553 AGCCCGGGCGGGCGAGGGCCTGG - Exonic
1196957203 X:120970391-120970413 AGCCCGGGCGGGCGAGGGCCTGG - Exonic
1196957885 X:120975251-120975273 AGCCCGGGCGGGCGAGGGCCTGG - Exonic
1196958567 X:120980111-120980133 AGCCCGGGCGGGCGAGGGCCTGG - Exonic
1196959248 X:120984971-120984993 AGCCCGGGCGGGCGAGGGCCTGG - Exonic
1197766072 X:130060278-130060300 GGCGGCGGCGCGCGAGGGGAGGG + Intergenic
1197774512 X:130110639-130110661 GGTCCGGGCGGGCGAGGCGCAGG + Intronic
1198051481 X:132956753-132956775 GGCCTAGGCGGGCGGAGGGCTGG - Intronic
1198388034 X:136147379-136147401 GGGCGGGGCGCGCGCGGGGCCGG - Exonic
1198388043 X:136147400-136147422 GGGCGCGGCTAGCCAGGGGCGGG - Exonic
1199724754 X:150568909-150568931 GCCGGCGGCGGGCGAAGGTCGGG + Intronic
1199846359 X:151695162-151695184 GGTCGTGGCGCGCGAGGCGCGGG + Intronic
1200000269 X:153056544-153056566 GGCGGCGGCGGACGGGGGTCGGG - Intronic
1200001912 X:153066525-153066547 GGCCGCGGCCGGTGGGGAGCTGG + Intergenic
1200002603 X:153069713-153069735 GGCCGAGGCGGGGGGGGGGAGGG + Intergenic
1200003306 X:153072790-153072812 GGGCGGGGCGGGACAGGGGCGGG + Intronic
1200004417 X:153077219-153077241 GGGCGGGGCGGGACAGGGGCGGG - Intergenic
1200005121 X:153080297-153080319 GGCCGAGGCGGGGGGGGGGGAGG - Intergenic
1200005820 X:153083500-153083522 GGCCGCGGCCGGTGGGGAGCTGG - Intergenic
1200163284 X:154019853-154019875 GGCCGCGGCGGGCGCGGGCCTGG + Exonic
1200185223 X:154178267-154178289 GGCCGAGGCGGGCGGAGGTCAGG + Intergenic
1200190876 X:154215405-154215427 GGCCGAGGCGGGCGGAGGTCAGG + Intergenic
1200196627 X:154253207-154253229 GGCCGAGGCGGGCGGAGGTCAGG + Intergenic
1200202282 X:154290325-154290347 GGCCGAGGCGGGCGGAGGTCAGG + Intronic
1200217529 X:154374674-154374696 GCGCGGGGCGGGCGCGGGGCGGG - Intergenic
1200217536 X:154374685-154374707 GGCCGGGCCGGGCGCGGGGCGGG - Intergenic
1200350559 X:155490044-155490066 GGCGGGGGCGGGTGGGGGGCAGG - Intergenic
1201291244 Y:12421782-12421804 GGCCGCGGTGGGCGAGGGGCTGG - Intergenic