ID: 1185778811

View in Genome Browser
Species Human (GRCh38)
Location X:2828855-2828877
Sequence GAGAGGACCCGCGCCCGCGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 85}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185778797_1185778811 20 Left 1185778797 X:2828812-2828834 CCAGGCGGCGCGCGGGCTTGCGG 0: 1
1: 1
2: 7
3: 12
4: 135
Right 1185778811 X:2828855-2828877 GAGAGGACCCGCGCCCGCGGGGG 0: 1
1: 0
2: 0
3: 9
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185778811 Original CRISPR GAGAGGACCCGCGCCCGCGG GGG Exonic
900989450 1:6091572-6091594 AAGAGGACCCCCGGCCGCCGCGG - Intronic
902501522 1:16914405-16914427 GAGGGGACCCCGGCCGGCGGAGG - Intronic
903349740 1:22710681-22710703 GTGGGGACCCGGGCTCGCGGCGG + Intergenic
906154527 1:43606265-43606287 GAGAGGAGCAGCGGCGGCGGCGG + Exonic
906508311 1:46395996-46396018 GGGAGGACCCGCGCCAGCACTGG + Intronic
921599287 1:217089724-217089746 GGCCGGCCCCGCGCCCGCGGGGG - Intronic
923461590 1:234214040-234214062 AAAAGGACCAGCGCCTGCGGAGG - Intronic
1064086503 10:12349642-12349664 GGGAGGGACCGCGGCCGCGGCGG + Exonic
1066370637 10:34815525-34815547 GAGGGGTCCCGCGCCCCCGGAGG - Intergenic
1067812668 10:49442046-49442068 AACAAGACCCGCGCCCCCGGGGG + Intergenic
1071997559 10:91162980-91163002 GAGGGAGCCCGCGCCGGCGGGGG - Intergenic
1073812435 10:107164959-107164981 GCCGGGACCCGCGGCCGCGGGGG - Intergenic
1075106614 10:119543408-119543430 GAGAGGGCGCCCACCCGCGGCGG - Intergenic
1084939911 11:72607004-72607026 GAGGGGACCCCCGCCCAGGGAGG - Intronic
1087761743 11:102110370-102110392 GAGAGGAGGCGGGGCCGCGGCGG + Intergenic
1088604185 11:111512715-111512737 GGGAGGACCCGCGCCCTCCCAGG - Intergenic
1090204726 11:124877982-124878004 GACAGGACCCTCGCCAGGGGCGG - Exonic
1090699253 11:129279451-129279473 CCGAGGACCCGCGTCCCCGGGGG - Intergenic
1096627255 12:52903571-52903593 GAGGGGCCCCGGGCCCCCGGCGG - Intronic
1104965493 12:132507150-132507172 GGGAGGATCCGCCCCCACGGAGG - Intronic
1106303882 13:28494217-28494239 GAGGGGACTCGTGCCTGCGGGGG - Intronic
1106853217 13:33818120-33818142 GGGAGGACGCGCGCTCGCGCGGG + Exonic
1110119467 13:71865340-71865362 GAGCGGACCAGCACCCGAGGAGG - Intronic
1110587592 13:77212895-77212917 GAGAGGTCCCGAGCCAGGGGTGG - Intronic
1113082771 13:106535329-106535351 GAGACGACCGGCGCGGGCGGCGG + Intergenic
1120765356 14:88323315-88323337 GCGAGGAGCCGCGGCCGGGGTGG - Intronic
1121101573 14:91253581-91253603 GAGCGGCCCCGCGAGCGCGGGGG - Intronic
1124167256 15:27339157-27339179 GAGAGGACCCGGGGCCTCTGTGG - Intronic
1128374353 15:67065160-67065182 GAGAGGACCCGAGCCCGAGAGGG - Intronic
1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG + Intronic
1132105325 15:99059013-99059035 GAGCGGATCCGCGCCGGCCGCGG + Intergenic
1132558617 16:583556-583578 GTGAGGGCCCGGGCCCGCTGGGG - Exonic
1132566981 16:628053-628075 GAGGGGACTCGCGGCCGCGATGG + Exonic
1132629058 16:908006-908028 GAGAGGAGCCGGCCCCGCAGAGG - Intronic
1133058160 16:3157860-3157882 GAGAGGACACACACCCGCGAGGG - Intergenic
1133232094 16:4371776-4371798 GAGAGGCCCCGCCCCTGCCGCGG + Intronic
1134024646 16:10944644-10944666 GAGCGGCCCAGCGCCCGCGGCGG - Exonic
1135003854 16:18801322-18801344 GAGAAGGGCCGGGCCCGCGGCGG + Intronic
1136609422 16:31357142-31357164 GGGAGGAGCCGGGGCCGCGGGGG + Intronic
1139615362 16:68085379-68085401 GAGCGCACCCGCGGCGGCGGTGG + Intronic
1141582830 16:85011809-85011831 GTGTGTACCCGCGCCCGCGGCGG + Intergenic
1142155748 16:88532244-88532266 CTGAGGACCCGCGTCCGGGGTGG - Intronic
1142683107 17:1561967-1561989 GAGAGGCCCCGCGGCGGCCGAGG - Intronic
1153382537 18:4455134-4455156 GAGAGGAGCCGAGGCGGCGGCGG + Exonic
1153445968 18:5173578-5173600 GAGAGGACCCCTGCCCTCTGGGG - Intronic
1153935104 18:9914219-9914241 GAGCGGGGGCGCGCCCGCGGCGG - Exonic
1158893552 18:61894156-61894178 GCGAGCACCCGAGCCCGCCGCGG - Intronic
1163884821 19:19956335-19956357 GTGAGGACCTGCGCCCGCGCTGG - Intergenic
1164536105 19:29087609-29087631 GACAGGCCCCGCACCCGGGGAGG + Intergenic
1165328852 19:35130193-35130215 GTGAGGACCCGCGCCGGCACTGG - Intronic
1165860758 19:38908043-38908065 GGCAGGACCCGAGCCAGCGGTGG + Intronic
1167818662 19:51906507-51906529 CAGAGGACCCGCGCCGGCACCGG - Intronic
1167893254 19:52559504-52559526 CAGAGGACCCGCGCCTGCACCGG - Intronic
1202714324 1_KI270714v1_random:33860-33882 GCGCGGACCCGCGCCCACGACGG - Intergenic
929576971 2:43058032-43058054 GAGAGGATCTGGGCACGCGGGGG - Intergenic
931671646 2:64653573-64653595 GAGGGGATCCGCGGGCGCGGGGG - Intronic
934954800 2:98608561-98608583 GAGAGGTGGCGCGTCCGCGGCGG + Exonic
945225713 2:207529845-207529867 GAGCGGCCCCGCCCCCGCGCTGG - Intronic
946185635 2:217979003-217979025 CTGAGGACCCGCGGCCGGGGAGG + Intronic
948988717 2:241541264-241541286 GACAGGCCCCGCCCCCGCCGCGG - Intergenic
1171810731 20:29743057-29743079 GAGAGGATCCGAGGGCGCGGAGG + Intergenic
1180043856 21:45293893-45293915 GAGGGGACCAGCGCCCCGGGGGG + Intergenic
1180177783 21:46098604-46098626 GAGAGGCCCTGCGCCCCCGGAGG - Intronic
1180260901 21:46668002-46668024 GAGAGGACCCGCCCTCGAGTCGG + Intergenic
954994835 3:54871864-54871886 GAGGGGACCAGCGTCCGCAGGGG - Intronic
978777031 4:112515186-112515208 GAGACGGCCCGCGCCCGGGAAGG + Exonic
985129226 4:186724452-186724474 GGGAGGCCAGGCGCCCGCGGCGG - Intronic
986858972 5:11904320-11904342 GGGAGGAGCCTCGCCCTCGGCGG - Intergenic
992160296 5:73994269-73994291 GAGACGACCCACGCCCTCGGGGG + Intergenic
993502380 5:88678424-88678446 CAGAGCACCCGGACCCGCGGCGG - Intergenic
999300014 5:150485537-150485559 ACAAAGACCCGCGCCCGCGGCGG - Intergenic
1003603619 6:7541364-7541386 GGGAGGACCTGCGCTCGCGGGGG - Intergenic
1005293340 6:24400180-24400202 CAGAGGACCCGCGCCGGCACCGG + Intergenic
1005520370 6:26595982-26596004 CTGAGGACCCGAGCCCGCGCGGG + Intergenic
1005859155 6:29888084-29888106 GAGAGGAGCCGCGGGCGCCGTGG + Intergenic
1005931795 6:30490043-30490065 GAGGGGACCCGCGCCGTCCGTGG - Intronic
1006052810 6:31356806-31356828 GAGAGGAGCCGCGGGCGCCGTGG - Exonic
1011258586 6:85449733-85449755 GAGAGGACCCAGGCGCGGGGCGG + Intronic
1014109282 6:117602363-117602385 GAGGGGACCCCCGCGCGCGCGGG + Exonic
1014109283 6:117602370-117602392 GAGTGTGCCCGCGCGCGCGGGGG - Intronic
1015244803 6:131063391-131063413 GAAAGGTCCCCCGCCCGCGCAGG - Intergenic
1019033046 6:169030082-169030104 GAGAGGACCAGCCCCCTCCGAGG - Intergenic
1019340116 7:504884-504906 GGGAGCCCACGCGCCCGCGGTGG - Intronic
1035264764 7:157684802-157684824 GGGAGAACCAGCGCCCGCGCGGG - Intronic
1035283486 7:157792257-157792279 GAGAGGCCAGGCGCCCGCAGCGG + Intronic
1038554120 8:28494558-28494580 GCGGGGGCCCGGGCCCGCGGTGG + Intronic
1049517314 8:143067595-143067617 GCGAGGACCCGCGTCGGCGCTGG + Intergenic
1050744067 9:8857444-8857466 GAGAGGACCTCTGCCCGAGGAGG + Intronic
1053902317 9:42806928-42806950 GAGAGGAGGCGTCCCCGCGGCGG + Intergenic
1054532659 9:66198591-66198613 GAGAGGAGGCGTCCCCGCGGCGG - Intergenic
1055091034 9:72364959-72364981 GGGAGGACCGGCGGCCGCAGCGG + Intronic
1061666626 9:132163675-132163697 CAGGGGCCCCGCGCCCGCCGCGG + Intronic
1062628896 9:137454880-137454902 GAGAGGACCTGCCCCTGAGGTGG - Intronic
1185778811 X:2828855-2828877 GAGAGGACCCGCGCCCGCGGGGG + Exonic
1186795696 X:13044599-13044621 CAGAGGACCCAGGCCCTCGGAGG - Exonic