ID: 1185782140

View in Genome Browser
Species Human (GRCh38)
Location X:2857945-2857967
Sequence CCCTGAACACAGATGGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 208}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185782140 Original CRISPR CCCTGAACACAGATGGAGCT AGG Intronic
901462215 1:9398511-9398533 CCCTGAACTCAGCTGGGGATGGG - Intergenic
901872865 1:12148331-12148353 CCCTGACCACAGAGGCAGCCAGG - Intergenic
902669710 1:17964594-17964616 CCTTAAAGACAGATGGACCTAGG - Intergenic
902873602 1:19328347-19328369 GCTTGGAGACAGATGGAGCTTGG + Intronic
903041660 1:20535250-20535272 GCCTGAGCACAGATGCAGGTGGG + Intergenic
904189618 1:28733517-28733539 CCCTGAACAAGGAAGGAACTTGG - Intergenic
904541855 1:31238940-31238962 CCCAGAACACAGATGAACATGGG + Intronic
905024159 1:34838361-34838383 CACTGGACACAGATGGAGTAAGG + Intronic
905289228 1:36910235-36910257 CCCTGAGGACAAATGGAGCCTGG - Intronic
906322147 1:44823448-44823470 CTCTGAAGACAGATACAGCTCGG - Intronic
907299318 1:53476697-53476719 CCCTGCACACAGAGGGACCCGGG + Intergenic
907304771 1:53507387-53507409 CTCTGAAGCCAGATGGACCTGGG - Intronic
909046606 1:70718186-70718208 CTCTGAAATCAGATGGAACTGGG - Intergenic
912211083 1:107557578-107557600 TCCTGAACACAATTGGAGTTGGG - Intergenic
912458851 1:109818076-109818098 ACCTGGACTCAGATGGGGCTGGG + Intergenic
913318719 1:117574247-117574269 CCCCGAAGGCTGATGGAGCTGGG - Intergenic
913442916 1:118917988-118918010 GCCTGAACACAGAAAGAGCTTGG - Intronic
915476161 1:156153993-156154015 CCCTGAACCCAGCTGGGGCTGGG + Intronic
920270787 1:204762199-204762221 CCCTGAACTTAAATGTAGCTTGG - Intergenic
922424717 1:225482197-225482219 CCCTAAACACACATGGACTTAGG + Intergenic
922572094 1:226640241-226640263 GCCTGAACAGAGATAGTGCTGGG - Intronic
922618611 1:226977586-226977608 CCCAGAGCACAGGTGGGGCTGGG - Intronic
924165079 1:241272560-241272582 GCCTGGATACAGATGGGGCTAGG - Intronic
1063506157 10:6601597-6601619 CTGTGAACACAGATGAAGTTTGG + Intergenic
1066489774 10:35883316-35883338 CCCTGAACCCACATGGTCCTGGG + Intergenic
1067055111 10:43045558-43045580 CCCTGCACATGGATAGAGCTGGG - Intergenic
1067711147 10:48652104-48652126 CCCTGACCACAGATGCCGCCTGG + Intronic
1067824390 10:49559402-49559424 ACCTGAACACAGAGGTAGCATGG + Intergenic
1069789521 10:71010767-71010789 CCCTCAACACTGAAGGAGCTGGG - Intergenic
1069807105 10:71132873-71132895 CCCAGCAGACAGGTGGAGCTGGG - Intergenic
1070537973 10:77393562-77393584 CCCCTGAGACAGATGGAGCTGGG + Intronic
1071560993 10:86646769-86646791 TCCAGAGCAGAGATGGAGCTAGG + Intergenic
1074324194 10:112431867-112431889 CACTGAAAACAGATGGAGCTAGG - Intronic
1075544413 10:123343547-123343569 CTCTGGAAACAGATGGAGCTGGG + Intergenic
1076308595 10:129485091-129485113 TCCTGATCACAGACAGAGCTGGG - Intronic
1080020242 11:27552558-27552580 TGCAGAAGACAGATGGAGCTTGG - Intergenic
1080725681 11:34897965-34897987 CCCTGTACAGAGATGGAGGGTGG - Intronic
1083337007 11:61928395-61928417 CCCTCAAAATATATGGAGCTAGG + Intergenic
1083337047 11:61928659-61928681 CCCTCAAAATACATGGAGCTAGG + Intergenic
1084403713 11:68959414-68959436 CCCTGCACACAGCGGGAGCAGGG + Intergenic
1084879333 11:72159096-72159118 CCCTGAATAGAACTGGAGCTGGG - Intergenic
1084953511 11:72679412-72679434 CCCTGGACTCAGCTGGGGCTGGG - Intergenic
1085238243 11:75031671-75031693 CCCTGAACACAGTAGTAGGTGGG + Intergenic
1085302750 11:75467946-75467968 CTCTGAACACAGAGGGCTCTGGG - Intronic
1091383807 12:79144-79166 CCGAGAACACAGAGGGAGCTGGG + Intronic
1094056357 12:26273115-26273137 CCCTGAGCATGGATGGAGATGGG - Intronic
1094285612 12:28789734-28789756 CACTGAACTAAGATGGAACTGGG + Intergenic
1094530021 12:31265666-31265688 CTCTGAAAGCAGATGGAGCTAGG + Intergenic
1096604104 12:52752741-52752763 CTCAGGACACAGATGGAGCTGGG - Intergenic
1098597651 12:72293412-72293434 CCCAGATTACAGATGGACCTAGG + Intronic
1101735515 12:107460034-107460056 CCCAGAACACTGATGTAGCAGGG - Intronic
1103323687 12:120106179-120106201 CACTGAACACAGATTGGGATGGG + Intronic
1104275461 12:127323084-127323106 CCCTGCACATATATGGGGCTGGG - Intergenic
1104322069 12:127761285-127761307 CCCTGAAGTCAGATGGCGCTGGG - Intergenic
1104713424 12:131001698-131001720 ACCGGAAGACAGATGGAGCCAGG - Intronic
1104723193 12:131057795-131057817 CCCACAACACAGGTGGAGCTGGG + Intronic
1105811409 13:23999561-23999583 CCCTGACTCCAGATGGAGTTGGG - Intronic
1106013425 13:25846218-25846240 CCCAGAACACAGGAGGAGCCTGG - Intronic
1108263703 13:48683023-48683045 GCAGGAACACGGATGGAGCTGGG - Intronic
1108914404 13:55589787-55589809 TGCTGAAGACAGATGGATCTTGG - Intergenic
1115981438 14:39056191-39056213 CCCTGAACAAAGACAGGGCTTGG - Intronic
1117630951 14:57690884-57690906 CTCTAAATACAGATGAAGCTTGG + Intronic
1117718906 14:58608856-58608878 GCATGAACACAGATTGATCTGGG - Intergenic
1118755817 14:68843258-68843280 CCCTGGTCACAGATGAGGCTGGG - Intergenic
1119811427 14:77523620-77523642 TCCTGCACTCACATGGAGCTGGG + Intronic
1120331776 14:83102541-83102563 TCAGGGACACAGATGGAGCTGGG + Intergenic
1121634507 14:95444769-95444791 CCCTGAGCCCTGATGGAGTTGGG + Intronic
1121691494 14:95880675-95880697 CCTTGAACTCAGCTGAAGCTGGG + Intergenic
1121771205 14:96542353-96542375 CACTGAACACAGTAGGAGATGGG + Intronic
1122623563 14:103073146-103073168 CCCTGACCAGAGATGGAGGGTGG - Intergenic
1122870996 14:104639026-104639048 CCCTGACCACAGATGGAGAGTGG + Intergenic
1123497953 15:20849240-20849262 CCCTGAACAAAGACAGGGCTTGG - Intronic
1123555184 15:21422867-21422889 CCCTGAACAAAGACAGGGCTTGG - Intronic
1123591429 15:21860199-21860221 CCCTGAACAAAGACAGGGCTTGG - Intergenic
1127723815 15:61728171-61728193 CCCTCTTCAGAGATGGAGCTTGG + Intergenic
1129194619 15:73956518-73956540 CCCTGAAGAGAGCTGGAGCCTGG + Intergenic
1129708165 15:77806460-77806482 ACCTGAAGGCAGGTGGAGCTGGG - Intronic
1129908270 15:79205210-79205232 CCCTGAACACAGCTGGGGCCAGG + Intergenic
1130987432 15:88853945-88853967 CCCTGAGCACTGAGGGTGCTGGG - Intronic
1131082754 15:89550647-89550669 GCAGGGACACAGATGGAGCTAGG + Intergenic
1131390583 15:92044615-92044637 ACCTGAAGACACATGGACCTAGG - Intronic
1132305888 15:100812064-100812086 CACAGAAGACAGATGGATCTTGG - Intergenic
1202963530 15_KI270727v1_random:150077-150099 CCCTGAACAAAGACAGGGCTTGG - Intergenic
1132665255 16:1078553-1078575 CCCTGCACCCAGATGGCGCCTGG - Intergenic
1133923866 16:10179232-10179254 TCCTGAACAAAGATGGGTCTTGG - Intronic
1134277932 16:12793027-12793049 CCCTGTAGGCAGATGCAGCTTGG + Intronic
1135461746 16:22649989-22650011 GCAGGCACACAGATGGAGCTGGG - Intergenic
1135474496 16:22762372-22762394 CCCAGAAAACAGATGGAGTTTGG + Intergenic
1137569112 16:49553126-49553148 CTCTGAAGGCAGAAGGAGCTGGG + Intronic
1137729449 16:50679254-50679276 CCCTGAGCACAGATGGGGGCGGG + Intronic
1138118926 16:54382523-54382545 GCCTGAACACAGGTGGAGTTTGG - Intergenic
1139283345 16:65788546-65788568 CCCTGAATGCACATGGACCTGGG - Intergenic
1140899040 16:79351383-79351405 CCCTGAACACACAAGGAGGTGGG - Intergenic
1141274430 16:82573730-82573752 CACTGATCACAGATGCCGCTGGG + Intergenic
1142008923 16:87704036-87704058 CCGTGATCACAGCTAGAGCTCGG + Intronic
1142132657 16:88437990-88438012 CTCCGAACACAGGTGGAGCAGGG - Exonic
1143045734 17:4077841-4077863 CCATGAAAACAGATGGCGTTTGG - Intronic
1145188009 17:20813055-20813077 TCCTGAACTCAGATGGTGCCCGG - Intergenic
1146006334 17:29162990-29163012 TCCTGCACACAGATGGGGCCAGG - Intronic
1146451686 17:32979561-32979583 CTCTGAACTCAGAAGGAGATCGG + Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1150121653 17:62608465-62608487 CCCTGAATACAGATGAAGCTGGG - Intronic
1152306269 17:79522476-79522498 CCCTGAAAATAGTTGGAGTTGGG - Intergenic
1152778586 17:82216614-82216636 CCCAGAACACAGACTGACCTTGG + Intergenic
1153317243 18:3736373-3736395 CCCTAAAAACAGATTGTGCTTGG - Intronic
1153896902 18:9571587-9571609 CACTGAACACAGGAGGAGATGGG + Intronic
1154455950 18:14525661-14525683 CCCTGAACAAAGACAGGGCTTGG - Intronic
1157901088 18:51518510-51518532 ACATGAACTCAGATGGAGCAGGG + Intergenic
1161261486 19:3340256-3340278 CCCAGAAAACAGAAGCAGCTTGG + Intergenic
1162334307 19:10050858-10050880 CCCTGAATAAACATAGAGCTGGG + Intergenic
1164295543 19:23906553-23906575 CCCTGCACACAGATGGGATTGGG + Intergenic
1164596303 19:29532675-29532697 CTCTGACCTCAGAGGGAGCTTGG + Intronic
1167646536 19:50708802-50708824 CACTCAACAAAGATGGAACTAGG + Intronic
1167904427 19:52646977-52646999 CCCAGAACAAAGACAGAGCTGGG - Intronic
1202658705 1_KI270708v1_random:49016-49038 CCCAGCACACAGCTGGAGATCGG - Intergenic
927936509 2:27079407-27079429 CCCTGAACACATATGTTCCTTGG + Intronic
929574072 2:43041358-43041380 CCCTGAATGGAGATGGGGCTGGG - Intergenic
930452538 2:51560301-51560323 CCCACAACATGGATGGAGCTGGG + Intergenic
931819885 2:65941224-65941246 ACCTGAACACAGAAGGAGCCTGG + Intergenic
932731994 2:74227955-74227977 TCCTGACCACAGAGGCAGCTAGG + Intronic
934984164 2:98872016-98872038 CCAGCAACACAGATGGAGCTGGG + Intronic
937702728 2:124882179-124882201 CCCTGAACTCAGCTGTGGCTAGG - Intronic
937852672 2:126649623-126649645 TGCAGAAGACAGATGGAGCTTGG - Intergenic
938284786 2:130102856-130102878 CCCTGAACAAAGACAGGGCTTGG - Intronic
938335427 2:130491416-130491438 CCCTGAACAAAGACAGGGCTTGG - Intronic
938354397 2:130629251-130629273 CCCTGAACAAAGACAGGGCTTGG + Intronic
944374533 2:199026576-199026598 CCCTGAACACAGAAGAAGGAGGG - Intergenic
945987987 2:216370509-216370531 CACTGAACAAAGTTGGAGGTTGG - Exonic
946478459 2:220031304-220031326 CCCTGAAACCAGATGGATCATGG + Intergenic
947862899 2:233374992-233375014 ACTTGAAAACAGATGGAGCCGGG + Intronic
948697716 2:239741680-239741702 CCATCCACACACATGGAGCTGGG + Intergenic
948720661 2:239898087-239898109 CCCAGCTCACAGATGGAGCAAGG + Intronic
948732440 2:239975597-239975619 CCCAGCACACAGAAGGTGCTCGG + Intronic
948884241 2:240874966-240874988 CCCTGAGCACAAATGCAGCTGGG + Intronic
1169686470 20:8279322-8279344 CCTAGAAGACAGATGAAGCTTGG + Intronic
1170253319 20:14311187-14311209 CACTTACCACAAATGGAGCTTGG - Intronic
1170838929 20:19908105-19908127 CCCTGCAGACAGATGGAGCATGG - Intronic
1172772310 20:37388909-37388931 CCCTGAGCACTGATGGAGGAAGG - Intronic
1173026791 20:39315036-39315058 CCCGGAGCATAGATGGAGATGGG + Intergenic
1174180874 20:48673487-48673509 CTCTGAGCACTGAAGGAGCTTGG + Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175529988 20:59668042-59668064 ACCTGTACACAGATAGAGGTGGG + Intronic
1175905047 20:62375516-62375538 CGCTGACCACAGATGGTGCTGGG + Intergenic
1176099955 20:63360426-63360448 CCTGGAGCACAGATGGACCTAGG - Intronic
1176169795 20:63691623-63691645 CCCTGAGCCAAGATGGAGGTCGG - Intronic
1176818212 21:13627682-13627704 CCCTGAACAAAGACAGGGCTTGG + Intronic
1177898602 21:26885311-26885333 CCATGAAGACATATTGAGCTGGG + Intergenic
1178105749 21:29317483-29317505 CCCTGAAATCAGTAGGAGCTTGG + Intronic
1179006947 21:37523419-37523441 CCCTGAACAAAGGTGGAAGTAGG + Intergenic
1179732558 21:43375819-43375841 CCCTAAAGACAGAGGGTGCTTGG - Intergenic
1180069953 21:45431284-45431306 CCCTGCACACAGCAGGTGCTCGG - Intronic
1180326171 22:11432535-11432557 CCCAGCACACAGCTGGAGATGGG - Intergenic
1181021129 22:20103609-20103631 CCAAGAACACAGATGCAGCAGGG - Intronic
1181624477 22:24113960-24113982 CCCTGAGCACATGTGGTGCTGGG - Intronic
1183716934 22:39538562-39538584 CCTTGTCCACAGATGGAGCAGGG - Intergenic
1184693697 22:46128586-46128608 CCCTGCACATAGGTGGAGCCAGG - Intergenic
950893731 3:16428694-16428716 CGTTGTACACACATGGAGCTAGG - Intronic
952943450 3:38460117-38460139 CCCCAAAAACAGATGGAACTAGG - Intronic
953250823 3:41244654-41244676 CTCTGAACTCAAATGGACCTGGG + Intronic
954395318 3:50290336-50290358 CCTTGATCACACTTGGAGCTGGG + Intronic
954653354 3:52178650-52178672 CCCTCAACAAAGAGGGAGCATGG + Intergenic
956014568 3:64867971-64867993 CCCTGAAGACACATGGGACTTGG + Intergenic
959256701 3:104024370-104024392 GCAGGGACACAGATGGAGCTGGG + Intergenic
965246529 3:166278681-166278703 ACAGGAACACGGATGGAGCTAGG + Intergenic
965622726 3:170656840-170656862 CCCAGAGCACAGAGAGAGCTGGG + Intronic
967831658 3:193925090-193925112 TGCAGAACACAGATGGATCTTGG + Intergenic
967865543 3:194187073-194187095 CCCTGCACACAGGCGGAGCTGGG + Intergenic
969091694 4:4698742-4698764 CCCTCCACACAGGTGGAGCTGGG + Intergenic
969631477 4:8341160-8341182 GCCTGAAGACAGATGGGGCCTGG - Intergenic
973945082 4:55947578-55947600 CCCTGAACAAAGACAGAGCTTGG - Intergenic
974251718 4:59394022-59394044 CCCTTAGCACAGCTCGAGCTGGG + Intergenic
974469723 4:62302816-62302838 CTCTGAACCCAGCTGGAGCCTGG + Intergenic
974893121 4:67906519-67906541 CCCTTAAAGCAGATAGAGCTTGG - Intergenic
975031358 4:69621848-69621870 GCAGGAACATAGATGGAGCTGGG + Intronic
976818157 4:89174447-89174469 TCCTGAACACAGAAGCAGCTAGG + Intergenic
976838902 4:89408053-89408075 CCCTGCCCACAGCTGGAGATTGG + Intergenic
981806183 4:148718053-148718075 CCCTAAAGAGAGAAGGAGCTTGG - Intergenic
984603518 4:181756816-181756838 CCCAGGGCACAGAAGGAGCTAGG - Intergenic
986532813 5:8757155-8757177 GCAGGAACATAGATGGAGCTGGG - Intergenic
987063861 5:14268831-14268853 CCGTGGACACAGATGGCACTGGG - Intronic
987787962 5:22526641-22526663 TGCTGAAGACAGATGGATCTTGG - Intronic
995264326 5:110139851-110139873 CCAAGAACACAGATGGAGTTCGG + Intergenic
995834992 5:116391340-116391362 CCTTGAACACTGAAGGGGCTAGG - Intronic
996907425 5:128616919-128616941 ACCTGAAAAGAGATGGAACTGGG - Intronic
997199235 5:131999736-131999758 CCCTGCATGCAGATGGAGGTGGG - Intronic
999287332 5:150402019-150402041 CCCTGTTGACAGATGGAGATTGG + Intronic
1004159555 6:13201367-13201389 CCCTGAAGAGAGAAGGAGCGTGG + Intronic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005107533 6:22240686-22240708 TCCTGAAGACAGAAGGAACTTGG - Intergenic
1007496295 6:42262101-42262123 CCCTGGGCAAAGAGGGAGCTTGG + Intronic
1008516171 6:52321170-52321192 GCCAGAACACAGATGGGGCTGGG + Intergenic
1013357249 6:109356904-109356926 AACAGAACACAGATGGAACTTGG + Intergenic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1017378205 6:153796235-153796257 CCTTGAAATCAGATGGACCTGGG + Intergenic
1019413003 7:914711-914733 CCCTGAACACACAAGGAGACAGG + Intronic
1019724334 7:2592806-2592828 CCCTGCACACAGCAGGTGCTCGG + Intronic
1021930456 7:25576302-25576324 CCTTTAAGACAGATGTAGCTTGG + Intergenic
1024675250 7:51632277-51632299 CCAGGAACACAGCTGGAGCAGGG + Intergenic
1026807412 7:73436808-73436830 CCCAGCACACAGATGGACATGGG - Intergenic
1026849719 7:73717260-73717282 GGCTGAACAGAGATGGTGCTGGG - Intronic
1027353402 7:77334270-77334292 GCAGGGACACAGATGGAGCTGGG + Intronic
1028658709 7:93241299-93241321 CACTGGTCACTGATGGAGCTAGG - Intronic
1029022174 7:97376313-97376335 GCAGGGACACAGATGGAGCTGGG + Intergenic
1029660699 7:101959219-101959241 CACTGCACACACATAGAGCTAGG - Intronic
1031572604 7:123377545-123377567 CCCGGAACCCAGATGAAGGTTGG - Intergenic
1032552466 7:132797196-132797218 CCCTGCACACAGCTGAAGCCTGG + Intronic
1034418123 7:150975824-150975846 CCCTGGACACACCTGGAGCCTGG + Intronic
1036103761 8:5817369-5817391 CCCTGAGCAAAGATGGAGCATGG - Intergenic
1037691334 8:21183719-21183741 CCATGAACCCAGGTGGAGCAGGG - Intergenic
1038581292 8:28751433-28751455 TGCTGCACACAGATGGCGCTGGG - Exonic
1041128195 8:54666838-54666860 CTCTGAGAACAGATGGGGCTTGG - Intergenic
1042448459 8:68917164-68917186 CACTGAACACAGCTAGAGTTGGG + Intergenic
1042759270 8:72253016-72253038 CCCTGAACAAAGATGCTGGTGGG - Intergenic
1044802556 8:95972272-95972294 GGCTGAAGACAGATGGTGCTGGG - Intergenic
1046739881 8:117816581-117816603 GCCTGAATATAGATGCAGCTGGG + Intronic
1047920730 8:129631954-129631976 CCCATAACACAGGTGGAGCCTGG - Intergenic
1048357280 8:133663932-133663954 TCCTGAAATCAGAAGGAGCTTGG + Intergenic
1048588051 8:135793702-135793724 CCCTGCAAAAAAATGGAGCTGGG - Intergenic
1048879871 8:138863454-138863476 CCCTGAGCAGAGGTGGGGCTGGG - Intronic
1049230025 8:141477129-141477151 GCCTGAAGGCAGATGGAGCTGGG - Intergenic
1051260703 9:15261563-15261585 CCCTGGACACAAATGAAGTTGGG - Intronic
1052347739 9:27427127-27427149 CCCTGAACTCTGATGCAGGTAGG - Intronic
1053201344 9:36153543-36153565 CCATGAACAGAGATGCAGCAAGG - Intronic
1056788698 9:89611293-89611315 CCCAGGACACAGATGCAGATTGG - Intergenic
1056937492 9:90927523-90927545 CCCTGAACACAGACGGGACCTGG - Intergenic
1062219610 9:135408064-135408086 CGCTGAGCACTGAAGGAGCTTGG + Intergenic
1062627053 9:137448104-137448126 GCCTGGACAGAGTTGGAGCTAGG - Exonic
1203529147 Un_GL000213v1:121821-121843 CCCTGAACAAAGACAGGGCTTGG - Intergenic
1185678388 X:1867474-1867496 CCCTGAACAAAGACAGAGCGGGG - Intergenic
1185782140 X:2857945-2857967 CCCTGAACACAGATGGAGCTAGG + Intronic
1187653649 X:21442846-21442868 GCAGCAACACAGATGGAGCTTGG + Intronic
1189167185 X:38871736-38871758 CCCTTAAGACAGTTGGAGTTGGG - Intergenic
1193012908 X:76697476-76697498 CTCTGAACCCACCTGGAGCTTGG + Intergenic
1194482629 X:94445676-94445698 TGCAGAACACAGATGGATCTTGG + Intergenic
1195247077 X:103004558-103004580 CCCAGCAGACAGATGGAGCATGG + Intergenic
1195920428 X:109977999-109978021 CCCTGTACAGAGATGGAGGCAGG - Intergenic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic