ID: 1185789045

View in Genome Browser
Species Human (GRCh38)
Location X:2914658-2914680
Sequence TCCTCTCCAGGGTTTCTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 2, 2: 1, 3: 18, 4: 220}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185789045 Original CRISPR TCCTCTCCAGGGTTTCTTGA AGG Intronic
900137824 1:1125876-1125898 TGCTCTCCTGGGCTTCTTGAGGG - Intergenic
900917611 1:5649785-5649807 TCCTCCCAAGGGTCTCATGAGGG + Intergenic
901928939 1:12584388-12584410 TCCTTTCAAGGGTCTGTTGAGGG + Intronic
902262152 1:15234392-15234414 GGCTCTGCAGGGTTTCTGGAGGG + Intergenic
902664790 1:17929953-17929975 ACCCCTCCAGGGTGTCATGATGG - Intergenic
902670076 1:17967041-17967063 TCCTGCCCAGGGGTGCTTGATGG - Intergenic
903377354 1:22875332-22875354 TCCTCTCCAGGGTCTGTAGCAGG - Intronic
903753162 1:25642528-25642550 TCCTCCCCAGGGCTTAATGATGG + Intronic
908539311 1:65107518-65107540 TCTTCTCCAGGGTTTCACCATGG - Intergenic
909258183 1:73451137-73451159 TCAACTCCAGGCTTTCTTGATGG + Intergenic
909334698 1:74458572-74458594 CACTCTACAGTGTTTCTTGATGG + Intronic
909669166 1:78168819-78168841 TCTTCTCCATGGTGTCTGGATGG + Intergenic
910110184 1:83674532-83674554 CCCTCTCCCGGGTTTGTAGATGG - Intergenic
911075281 1:93867219-93867241 TCTTCTCAGGGGTATCTTGAAGG + Exonic
912068969 1:105783140-105783162 TCTTCTCCAGAGCTTCTAGAGGG - Intergenic
912980122 1:114363889-114363911 TTCTCATCAGGGTTTCTTGCCGG + Intergenic
914258283 1:145977973-145977995 TCTTCTCCAGGGTCTCATGTGGG - Exonic
915633748 1:157172259-157172281 TCCTCTGCAGGGTTGCTGGGAGG - Intergenic
915637573 1:157197213-157197235 TCCTCTGCAGGGTTGCTGGGAGG - Intergenic
915658012 1:157377562-157377584 TCCTCTGCAGGGTTGCTGGGAGG - Intergenic
915671002 1:157489087-157489109 TCCTCTGCAGGGTTGCTGGGAGG + Intergenic
916648791 1:166816304-166816326 CCCTCTCCAGGGTCTCTTCTTGG - Intergenic
916945049 1:169718092-169718114 CTCTCTCCAGGGTTTTGTGATGG - Intronic
919003448 1:191864671-191864693 TCCTCTCCCCAGTTTTTTGAGGG - Intergenic
920351508 1:205341048-205341070 TCCTGGGCAGGGTTTCTTAAAGG - Intronic
921310287 1:213835565-213835587 GCCTCTCCTGCATTTCTTGAGGG - Intergenic
922573840 1:226649016-226649038 TCCTCTCCAGCCTTCCTTGGAGG - Intronic
923154849 1:231269250-231269272 TCCTCTCCTGGTCTTCCTGAAGG - Intronic
924323397 1:242871528-242871550 ACCACTCCAGGATTTATTGAGGG - Intergenic
924534095 1:244918998-244919020 ACGTCGCCAGGGATTCTTGACGG + Intergenic
1063322310 10:5061623-5061645 TCAGCTCTGGGGTTTCTTGAAGG - Intronic
1065475323 10:26130510-26130532 TCCTCTCAAGGGTATCTTAAAGG - Intronic
1065526811 10:26630606-26630628 TCCTCTCAAGGGTATCTTAAAGG - Intergenic
1066250409 10:33627312-33627334 TCCAGTCATGGGTTTCTTGAAGG + Intergenic
1067431364 10:46248138-46248160 TCATCCCCAGGGTTTATAGAGGG - Intergenic
1067442043 10:46314062-46314084 TCATCACCAGGGTTTATAGAGGG + Intronic
1067971986 10:50982607-50982629 CACTCTCCTGAGTTTCTTGAGGG + Intergenic
1068094249 10:52470427-52470449 AACTCTCCAGGGCTGCTTGAAGG + Intergenic
1068816788 10:61324816-61324838 CCTTTTGCAGGGTTTCTTGATGG + Intergenic
1069980479 10:72248952-72248974 TCTTCTTCAGGGTTTCCTGTGGG + Intergenic
1070470873 10:76778090-76778112 TCCTCTCCTTGGCTTGTTGATGG - Intergenic
1072502586 10:96032929-96032951 CCCTGTCCAGTCTTTCTTGAGGG - Intergenic
1075419909 10:122293012-122293034 TCATCTCCTGGGCTTTTTGAGGG + Intronic
1075810040 10:125218648-125218670 TGCACTCCAGCGTTTCCTGAGGG + Intergenic
1076279936 10:129237849-129237871 TCTGCGTCAGGGTTTCTTGAAGG - Intergenic
1076930882 10:133530964-133530986 TCCTCCCAAGAGTTGCTTGATGG - Intronic
1077195416 11:1277393-1277415 GCCTTTCCAGGGTGTCTTGCGGG - Intronic
1082113746 11:48305552-48305574 CCCTCTCTAGGGTTTCCTGGTGG + Intergenic
1084793586 11:71490116-71490138 TTCTCTCCAGGGTCTCCAGAAGG - Intronic
1092156476 12:6285111-6285133 TCTTCTCCACGTATTCTTGACGG - Intergenic
1092937255 12:13375568-13375590 GCATCTCCTGGGTTCCTTGAAGG + Intronic
1094409647 12:30155623-30155645 TCTTCTGCAGGGTCTCCTGAAGG + Intergenic
1094739640 12:33274389-33274411 TCCTTTACAGTGTTTTTTGAGGG - Intergenic
1097370721 12:58777183-58777205 TGTTCTCCAGGGGTTTTTGACGG - Intronic
1099643995 12:85327156-85327178 ACCTCTCCAGCCTTTCTTGCTGG + Intergenic
1100581510 12:95943812-95943834 TCCTCCCCAGTGCTTCTTAAAGG + Intronic
1103135011 12:118499466-118499488 TCCTCTCCTTCTTTTCTTGATGG + Intergenic
1104672580 12:130690843-130690865 CCCTCACCAGGCTTTCCTGAGGG - Intronic
1106220500 13:27742685-27742707 TCCTCAGCAGGGTTTCCTGCAGG - Intergenic
1106350321 13:28923685-28923707 TGCTGTCCAGTGCTTCTTGATGG + Intronic
1107237811 13:38193927-38193949 TCCTCCTCAGGCTTTCTGGAAGG - Intergenic
1108180834 13:47838198-47838220 TCCTCTCCTTTGTTTCCTGAGGG + Intergenic
1113606620 13:111612474-111612496 TCCTCCCCGGGCTGTCTTGAAGG + Intronic
1114082400 14:19212654-19212676 TCCTCCCCCTGGCTTCTTGATGG + Intergenic
1117252999 14:53953972-53953994 TCCTCCCCAGGGTCTCCTCAAGG + Intronic
1117717872 14:58599345-58599367 TCGTCTGCAGAGTTTCTTGGTGG + Intergenic
1120105525 14:80489831-80489853 TCCTGACCAGGGTATCTTGTAGG + Intronic
1120820572 14:88908245-88908267 TCCTTTCCAGCCTTTCTTGCAGG + Intergenic
1121582405 14:95040705-95040727 TCCTCAGCATGGTCTCTTGAGGG - Intergenic
1121831446 14:97055731-97055753 TCCTCTGCAGCCGTTCTTGATGG + Intergenic
1122146949 14:99696898-99696920 TCCTTTCCAGGCTTGCTTTAAGG + Intronic
1124017321 15:25888445-25888467 TCCTTTCCAGGTTTTCATAATGG + Intergenic
1124122522 15:26901307-26901329 TCCTCTCCAGTGTTTACTGTTGG + Intronic
1124733459 15:32221410-32221432 CCCTCCCCACGGTTTGTTGATGG + Intergenic
1129084726 15:73076896-73076918 TTCTCTCCAGGGATTATTGTAGG + Intronic
1129443292 15:75598294-75598316 TCCTCTCCAGGATTCCTTTTGGG + Exonic
1136277243 16:29186315-29186337 TCCTCTGCAGGGTTTCTTCTGGG + Intergenic
1138108046 16:54301177-54301199 TCCTCTCCAGGTTTTGATGGTGG - Intergenic
1138550789 16:57747240-57747262 TCCTCTCCAGGGCTTCAGGTAGG - Intronic
1138691029 16:58768867-58768889 GCCTCTGCTGGGTTTCTTAAAGG + Intergenic
1140760702 16:78106099-78106121 GCCACTCCATGGATTCTTGAGGG + Intronic
1142081623 16:88152359-88152381 TCCTCTGCAGGGTTTCTTCTGGG + Intergenic
1143740838 17:8952939-8952961 TCCTGTCCAGGGGCTGTTGAAGG - Intronic
1147722357 17:42547021-42547043 ACCTCTCCAGGGATCCCTGAGGG - Intergenic
1148360197 17:47005444-47005466 CCCTCTGCAGTGTTTTTTGAGGG + Intronic
1148758278 17:49985998-49986020 TCCCCTCCAGGCTTAGTTGATGG + Intergenic
1148973008 17:51500679-51500701 GCCTATTCAGGGATTCTTGATGG + Intergenic
1151654387 17:75488992-75489014 TCATCTCGAGGTTCTCTTGAGGG + Intronic
1151961914 17:77410015-77410037 TCCTCTCCGGGGTTTTCTGTGGG + Intronic
1152435609 17:80274436-80274458 TCAGCTCCCGGGTTTCTTGCTGG + Intronic
1156697506 18:39784493-39784515 GCCTCTCTGGGGTTTCTTGCAGG - Intergenic
1162545221 19:11325111-11325133 TGCTTTCCAGGGTGTGTTGAGGG - Exonic
1163229190 19:15988414-15988436 TCCAGTCCAGGGATTCATGATGG - Intergenic
1164458515 19:28428240-28428262 CCCTCCCCAGGGTTCCTGGAGGG + Intergenic
1166164599 19:40978389-40978411 TCCTCCACAGGGTTTTTTGGGGG - Intergenic
925915314 2:8600390-8600412 TCCTCTCGAGGGTCTCATGGTGG + Intergenic
929723568 2:44398413-44398435 GGCTCTCCAGGGTTTCTGCAAGG + Intronic
931001681 2:57792239-57792261 TCCTCTTTAGCATTTCTTGACGG + Intergenic
934466081 2:94264339-94264361 TTCTCTCTATGGTTTCTTTAGGG + Intergenic
935677590 2:105609330-105609352 TCTTCTAAAGGGTATCTTGAAGG - Intergenic
938150866 2:128881229-128881251 TTTTCTTCAGGGTTTCTTTAAGG - Intergenic
938395571 2:130945232-130945254 TCCTTTCCTAGTTTTCTTGATGG + Intronic
938494184 2:131783949-131783971 TCCTCCCCCTGGCTTCTTGATGG - Intergenic
939517871 2:143191540-143191562 TCCTATCAAGGGACTCTTGAGGG - Intronic
943378716 2:187116158-187116180 TCATCTACAGGGATTCTTCAGGG - Intergenic
943749538 2:191497009-191497031 AGCTCTCCAGGCTCTCTTGAAGG + Intergenic
945805373 2:214483966-214483988 TCTTCTCTAGAGTTTCTGGAGGG - Intronic
946902720 2:224387825-224387847 TCTTCTCTAGCATTTCTTGAGGG - Intronic
947137745 2:226992067-226992089 TCCTTTGCAGGCTTTCTCGAAGG - Intronic
1168835482 20:874515-874537 TCCCCTCCAGGTGTTCTTGGAGG + Intronic
1169480291 20:5974036-5974058 TCCTTTCCTGGGTTTTATGATGG + Intronic
1171064970 20:22006550-22006572 TCCTCTCAGGGGTTTCTTAGAGG + Intergenic
1171839945 20:30197299-30197321 GACTCTCCAGGGATTCCTGACGG - Intergenic
1172750176 20:37245319-37245341 TCCTCCCCAGCATTTCCTGAGGG + Intergenic
1175391141 20:58628174-58628196 TCCTGTCTAGGGTTTCTGGAAGG + Intergenic
1176613734 21:9010433-9010455 TCCTCCCCCTGGCTTCTTGATGG + Intergenic
1177390230 21:20459707-20459729 GCTTCTCCAGGGTCTCTTGGTGG - Intergenic
1178603182 21:34012705-34012727 TCTTCACCAGGGCTTCTGGAGGG - Intergenic
1179367210 21:40769549-40769571 ACCTCTCCAGGGATGGTTGAAGG - Intronic
1179532816 21:42031817-42031839 GCTTCTCCAGGGTGTCTTCAGGG - Intergenic
1180083696 21:45498030-45498052 AACTCTCCAGGGTTTCATGTGGG + Intronic
1180121468 21:45751546-45751568 TCCTCGTCTGGGTTTCATGATGG + Intronic
1180498377 22:15910016-15910038 TCCTCCCCCTGGCTTCTTGATGG - Intergenic
1182554051 22:31119474-31119496 TTCACTCCAGGGTTTCTTGTTGG - Intronic
1182818593 22:33191700-33191722 TAATCTACAGGGTTTCTAGAAGG + Intronic
1185004926 22:48270178-48270200 GCCTCTCCATGGTTTGTAGAAGG + Intergenic
951621500 3:24606698-24606720 TCCTCTCCCGTGCTTCTTGATGG + Intergenic
953015461 3:39071453-39071475 TCATCTCCATGGTTTCCAGAAGG + Intronic
954449317 3:50563202-50563224 TCCTGTCCAGGGTTGCATGTAGG + Intronic
954813987 3:53266037-53266059 TCCACTGCAGGATTGCTTGATGG - Intergenic
956163939 3:66382315-66382337 TCCTGACCACGGTTTCTTGTCGG + Exonic
956164826 3:66388843-66388865 TACTCTCCTGGATTTCTTGTGGG - Intronic
956710781 3:72036867-72036889 TCCTCACCAGGCTTCCTTGCTGG - Intergenic
956744638 3:72301744-72301766 ACCTATCCAGTGTTTATTGAAGG - Intergenic
959385840 3:105705385-105705407 TCTTCTCCAGGATTTCATGCAGG + Intronic
959747424 3:109792934-109792956 TCCTCTCCAGGGCTTCTCAGAGG - Intergenic
960274805 3:115716556-115716578 TCCTCTCCATAATTTCTTGGTGG + Intronic
961818486 3:129563373-129563395 TCCTCTCCAGGGTGTCTCCACGG + Intronic
961866369 3:129956236-129956258 TCCCCTCTAGGGCATCTTGACGG + Intergenic
963531215 3:146475532-146475554 TCCTCCCCAGGCTTTGTTGCTGG + Intronic
965875959 3:173320454-173320476 TTCTCTTAAGGTTTTCTTGAGGG - Intergenic
966941724 3:184752238-184752260 ACCTCTCCAGGGATGGTTGAGGG + Intergenic
967815553 3:193795550-193795572 TCATCTCCAGGGCTTCGTGAAGG - Intergenic
972063280 4:34908916-34908938 TCCTCTCCACCATTTTTTGAGGG - Intergenic
972133974 4:35868658-35868680 TCCTCTCAAGGTTTTCTAAACGG + Intergenic
974492961 4:62590269-62590291 TCCTTGAAAGGGTTTCTTGAAGG - Intergenic
978096249 4:104782237-104782259 ATCTCTTCAGGATTTCTTGATGG + Intergenic
978518462 4:109594684-109594706 TTCTCTCCAGGGATTATTGAGGG - Intronic
981616716 4:146650367-146650389 CCCTCTCCAGGGTTTCATGGTGG + Intergenic
981763087 4:148215594-148215616 TACTTTCCAGGGTATGTTGAAGG - Intronic
982557298 4:156883739-156883761 TCCTATCCAGGTTTTCTTTAAGG - Intronic
982704222 4:158689490-158689512 TCTTTGCCAGGGTTTTTTGAGGG + Intronic
983278246 4:165644856-165644878 TGGTCTCCAGGGCTTCTGGATGG + Intergenic
983308540 4:166025354-166025376 TCCTCTCCAGGATTTCCCAATGG + Exonic
983554552 4:169048075-169048097 ATCTCTCCTGGGTTTTTTGAGGG + Intergenic
984406339 4:179336399-179336421 TAATCTCCATGGTTTGTTGATGG - Intergenic
986244978 5:5998943-5998965 TCCTATTCAGGCTTTCTTCAAGG - Intergenic
986460032 5:7960591-7960613 CCCTCTCCTGGGCTTCTGGATGG + Intergenic
986966480 5:13278433-13278455 TCCTCTCCAGGGTGACGTAAAGG - Intergenic
987248947 5:16079469-16079491 TGTTCTCCAGAGTTTCTGGAAGG - Intronic
988164547 5:27568559-27568581 TCCTTTCCAGAGATTCTTGTGGG - Intergenic
988445518 5:31282049-31282071 TCCTCCACTGGGATTCTTGAAGG + Intronic
991906841 5:71522864-71522886 TCCTCTCCAACCCTTCTTGATGG - Exonic
993741664 5:91548774-91548796 TTCTCTCCAGGATTTATTGTTGG + Intergenic
994601630 5:101912793-101912815 TCCTCTTCAGGGTTCCATGTAGG - Intergenic
997162103 5:131619956-131619978 TCTTTCACAGGGTTTCTTGAAGG + Intronic
998443048 5:142178043-142178065 TCCTCTGCTCGGTTTCTTGTGGG - Intergenic
998696843 5:144650635-144650657 TCCTCTCCAGGATTTCATCCAGG - Intergenic
1000344628 5:160304469-160304491 TCATCTCCAGGGGGTCATGAGGG + Intronic
1000379218 5:160614077-160614099 TCCTCTCCAAGCCATCTTGAGGG + Intronic
1000890560 5:166796754-166796776 ACCTCTCCAGGATTTTTTAATGG + Intergenic
1002073772 5:176696268-176696290 CTCTCTCAAGGGTTTCTTGATGG + Intergenic
1004808234 6:19227671-19227693 TCCTGACCAGGGTATCTTGTAGG + Intergenic
1005726391 6:28653229-28653251 CCCTCACAAGGGATTCTTGAAGG + Intergenic
1006495015 6:34416448-34416470 TGCTATCCAGGGTTCCTTTAAGG - Intronic
1007949547 6:45859284-45859306 AGCTCTCCAGGGTATGTTGATGG - Intergenic
1008343513 6:50397197-50397219 TAATCTCCATGATTTCTTGATGG + Intergenic
1008487330 6:52050429-52050451 TCCTCTCCATGTGTTCTTTATGG - Intronic
1010896163 6:81367013-81367035 TCCTCTGCAGGTTTTGATGAAGG - Intergenic
1011215536 6:85001740-85001762 TCTTCTCCAGAGTTTGTGGATGG - Intergenic
1013662366 6:112310440-112310462 TCCTCTCCAGTCCTTCTAGAGGG - Intergenic
1015146249 6:129990842-129990864 TACTCTCCTGGGTACCTTGAAGG - Intergenic
1018247468 6:161836625-161836647 GCCTCTCCAGGATTTCTCCACGG + Intronic
1018645941 6:165948636-165948658 TCACCTCGATGGTTTCTTGATGG - Intronic
1018889545 6:167973654-167973676 GCCTCTGCAGGGTTTCTAGGAGG + Intergenic
1019765263 7:2844840-2844862 CCCCCTCCAGTGTTTCTGGAAGG - Intergenic
1020061543 7:5156171-5156193 TGCTCTCCAGTGGTTCTTCAAGG + Intergenic
1020095717 7:5367877-5367899 GCTTCTCCAGGCTTCCTTGAGGG + Intronic
1020166615 7:5812490-5812512 TGCTCTCCAGTGGTTCTTCAAGG - Intergenic
1020240585 7:6391491-6391513 CCCTCTGCAGGGTTTCCAGAAGG - Intronic
1023338708 7:39196855-39196877 TCCTTTCTGAGGTTTCTTGAAGG + Intronic
1026124864 7:67570620-67570642 TCCTCTCCTTGGTTTATCGATGG + Intergenic
1027555915 7:79664732-79664754 TCCTCTCTAGAGTTTCCTGGTGG - Intergenic
1028233017 7:88328379-88328401 TGCTCTCCTGGTTTTCTTCAAGG + Intergenic
1028838771 7:95403355-95403377 TACTCCCCAGTGTTTTTTGAGGG + Intergenic
1029025060 7:97407694-97407716 TCCTCTCTAGTGTTAATTGAAGG + Intergenic
1030073022 7:105713750-105713772 TCCTGACTGGGGTTTCTTGAGGG - Intronic
1030642167 7:112018453-112018475 TCCTCCTCAGGGTTTTTAGAGGG + Intronic
1031959627 7:127976913-127976935 TCCCCTACATGGTGTCTTGAGGG + Intronic
1032420730 7:131777063-131777085 TCTTCCCCAGGTTTTCTTAATGG + Intergenic
1032428925 7:131844773-131844795 TTATCTCAGGGGTTTCTTGAAGG - Intergenic
1033470933 7:141648106-141648128 TCCTCTCCAAGGCTTCTCCACGG + Intronic
1034262683 7:149766485-149766507 TCCTCTTCAGGGGTGCTGGAGGG - Intronic
1034499231 7:151439515-151439537 TCCTTCCCAGGGTCTCTTCAGGG - Intronic
1034537719 7:151736162-151736184 TCCTCACCAGGGGGTCTTCAGGG + Intronic
1034934958 7:155193086-155193108 TTCTCTCCAGGGCCTCTGGAGGG + Intergenic
1035908167 8:3536501-3536523 TCCTCTCCAGGGTATCTTCGAGG + Intronic
1035931140 8:3781614-3781636 TCAACTATAGGGTTTCTTGATGG - Intronic
1036072259 8:5454105-5454127 TCCTACCCTGAGTTTCTTGAAGG + Intergenic
1039066938 8:33617325-33617347 GCCTGTCCAGAGTTTCTTGGTGG + Intergenic
1042273785 8:66982168-66982190 TTTTCTCCAGAATTTCTTGATGG - Intronic
1044776560 8:95694963-95694985 TCCTCACCAGGTTATCGTGAAGG + Intergenic
1045999912 8:108407411-108407433 AGCTTTCCAGGGTTTCTTCATGG + Intronic
1049605027 8:143525393-143525415 CCCTCTTCAGGGCTTCTAGATGG - Intronic
1049822450 8:144644258-144644280 CTTTCTCCAGGGTTTCTGGAGGG - Intergenic
1050154151 9:2648087-2648109 TCCCCAGCAGGGTTTCTTAACGG - Intronic
1050474749 9:6028955-6028977 CCAGCACCAGGGTTTCTTGATGG + Intergenic
1051281859 9:15449298-15449320 CATTCTCCAGGGTTTCCTGAAGG - Intronic
1053570496 9:39300267-39300289 TCATCTCCAGAATTTCTTGTTGG - Intergenic
1054092118 9:60859282-60859304 TCATCTCCAGAATTTCTTGTTGG - Intergenic
1054113531 9:61134872-61134894 TCATCTCCAGAATTTCTTGTTGG - Intergenic
1054126650 9:61318745-61318767 TCATCTCCAGAATTTCTTGTTGG + Intergenic
1054594166 9:67047307-67047329 TCATCTCCAGAATTTCTTGTTGG + Intergenic
1055798999 9:80011424-80011446 TTCTCTCTAGGATTTCTTGTAGG + Intergenic
1058058104 9:100469387-100469409 TGCTCATAAGGGTTTCTTGAAGG + Intronic
1058780669 9:108331408-108331430 TATTCTCCAGGGCTTCTTCAAGG - Intergenic
1058805029 9:108582236-108582258 TCACCTCCAGGGGTTTTTGAGGG - Intergenic
1058919897 9:109603527-109603549 TCCTCTCCAGGGCTTGTTCTTGG + Intergenic
1060777911 9:126390036-126390058 TCCTGCCCAGGGTTTCTTATAGG - Intronic
1061100440 9:128487911-128487933 TCTCCTCCAGGGTTTGTTGTTGG - Exonic
1061750451 9:132773341-132773363 TCCTCTCCAGCCTTCCTGGATGG + Intronic
1062176046 9:135163663-135163685 GCCTCTGGAGGGGTTCTTGAGGG - Intergenic
1062176666 9:135167014-135167036 GCCTCTGGAGGGTTTCTTGAGGG + Intergenic
1185788899 X:2913610-2913632 TCCTCTCCAGGGTTTCTTCAAGG + Intronic
1185789045 X:2914658-2914680 TCCTCTCCAGGGTTTCTTGAAGG + Intronic
1187497434 X:19807565-19807587 TCCTCTCCTGTGTTTCTTCATGG + Intronic
1187579185 X:20590665-20590687 TGCTGTTCAGGGTTTCTTCATGG + Intergenic
1188104987 X:26138831-26138853 ACCTCTCCTGGTTCTCTTGAGGG - Intronic
1193947437 X:87755550-87755572 TACTCTTCAGTGTTTCCTGAAGG - Intergenic
1200390768 X:155944636-155944658 TGCTTCCCAGGGTATCTTGATGG + Intergenic
1201285936 Y:12378709-12378731 TCCTCTCCATGGTTTCCTGAAGG - Intergenic
1201286072 Y:12379756-12379778 TCCTCTCCAGGGTTTCTTCAAGG - Intergenic