ID: 1185789975

View in Genome Browser
Species Human (GRCh38)
Location X:2921822-2921844
Sequence CTGTAACAGTTGAGTACTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 2, 1: 0, 2: 1, 3: 7, 4: 95}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185789975 Original CRISPR CTGTAACAGTTGAGTACTGA TGG (reversed) Intronic
900887768 1:5427533-5427555 CTTTAACAGATGAGGACTGAGGG + Intergenic
907830980 1:58064061-58064083 CTGTAACAGTTGAGGAATAAAGG - Intronic
909014855 1:70370418-70370440 CTGTAACAGGTGAGTGATAACGG - Intronic
911305337 1:96225321-96225343 CTGTCACAGATGCCTACTGATGG + Intergenic
913253799 1:116936100-116936122 TTGTAACAGTTGATAACTGAGGG - Intronic
913304368 1:117410191-117410213 ATGTAACTGGTGAATACTGAAGG + Intronic
914752570 1:150545568-150545590 TTGTAACTGCTGAGAACTGAAGG - Intergenic
1067168122 10:43881720-43881742 CTATAACACATGAGAACTGAAGG - Intergenic
1067706954 10:48613317-48613339 CTGGGATAGATGAGTACTGAGGG - Intronic
1068011635 10:51458883-51458905 CTGCAACACTTGAGTATTCATGG + Intronic
1078531912 11:12143145-12143167 CTGTGAGACTTGGGTACTGAAGG + Intronic
1081319192 11:41669272-41669294 CTGTAGCATTTCAGTACTGATGG - Intergenic
1088277329 11:108101638-108101660 CTGTCACACTTGGGAACTGAGGG + Intronic
1091950655 12:4590432-4590454 CTGTATCAGGTGAGTGCAGACGG + Exonic
1093515274 12:19978564-19978586 AAGTAAAATTTGAGTACTGATGG + Intergenic
1095629958 12:44364348-44364370 AAGTAACAGTGGAGTTCTGAAGG - Intronic
1096767406 12:53904069-53904091 CTGTAACCCTTGTGTACTGTTGG + Intergenic
1107534849 13:41318716-41318738 CTTTAATAGTTGAGATCTGAAGG - Intronic
1108010441 13:46002292-46002314 CTGGAACACTTGTGTACTGTTGG + Intronic
1111134477 13:84023109-84023131 CTGTAACTGATGAGTACTTGAGG + Intergenic
1117488135 14:56219476-56219498 CTGTGATAGCTGAGTGCTGAGGG - Intronic
1123958699 15:25370052-25370074 CAGTAAGAGTTGAGTCCTGCTGG - Intronic
1126428306 15:48553253-48553275 ATGTAACATTTGGGAACTGAGGG - Intronic
1126668128 15:51093538-51093560 GTGTCACACTAGAGTACTGACGG - Intronic
1127025004 15:54794877-54794899 CTGTAACAATAGAGTTATGATGG + Intergenic
1134258023 16:12627315-12627337 ATGTAAGACTTGAGTACAGAGGG - Intergenic
1136382742 16:29903769-29903791 CTTGAAAACTTGAGTACTGAAGG - Intronic
1139180696 16:64744824-64744846 ATGTAACAGTTGTGTAATAAAGG - Intergenic
1150229188 17:63540738-63540760 CAGTAACAGTTTAGCACAGAAGG - Intronic
1151069656 17:71194308-71194330 CTATTACAGTTGAGTCCTGTTGG + Intergenic
1151857696 17:76734532-76734554 GTGTAGCAGTTGAGTAATGCTGG - Exonic
1153365361 18:4249541-4249563 CAGTAACCGTTCAGTAATGATGG + Intronic
1158300520 18:56047135-56047157 CTGTTTCAGTTGAGACCTGAGGG + Intergenic
1165652420 19:37502881-37502903 CTGGAACAGGTGAGAGCTGATGG + Intergenic
1167422891 19:49414344-49414366 CTCCAACAGTTGAGTTCTGTGGG + Intronic
927055030 2:19359240-19359262 CTGTAACATCTGAGTGCTTATGG + Intergenic
930497633 2:52168224-52168246 CTGTAACAGTTGCTAGCTGAAGG + Intergenic
931899229 2:66769516-66769538 CTGTAACAGATGATTAAAGATGG + Intergenic
937245524 2:120489776-120489798 CTCTAACAGTTGAGGAGTGCTGG - Intergenic
938755041 2:134371729-134371751 CTCTACCAGTTGAGTTCTAAGGG - Intronic
939497969 2:142946935-142946957 GTGAAACAGTTAAGTGCTGATGG - Intronic
942441610 2:176042688-176042710 CAGGAACAGTTGACCACTGAAGG + Intergenic
944481503 2:200161999-200162021 CTGTATCAGTTAGGTATTGACGG + Intergenic
1169783529 20:9334131-9334153 ATGTAAAAGTTGAGTACAGAAGG + Intronic
1174895722 20:54447911-54447933 ATATAACAGTGGAGAACTGATGG + Intergenic
1179264675 21:39792808-39792830 CAGCAGCAGTTGAGTATTGAAGG + Intronic
951090051 3:18561889-18561911 CTGTAATAGTTGAGTCAAGAAGG - Intergenic
952014078 3:28936400-28936422 CTGTAACTCTTGAGTACAGGTGG - Intergenic
953899696 3:46833094-46833116 TTGTAACTGTTGAGAACTTAGGG + Exonic
955150308 3:56360580-56360602 ATATAAGAGTTGTGTACTGAAGG + Intronic
955336753 3:58093156-58093178 CTTTAGCAGTTGTGTAGTGAAGG + Intronic
957112711 3:75986154-75986176 CTGTAACACTTGTGCACTGTTGG - Intronic
960178696 3:114548340-114548362 ATGTAAAAGGTCAGTACTGAAGG - Intronic
960223498 3:115145084-115145106 ATGTAACTGTTCAGTACTCAAGG - Intronic
964119212 3:153164291-153164313 CTGGAACAGCTGAGTTTTGAAGG - Exonic
966101179 3:176270262-176270284 CTGTTGGAGTTGAGTCCTGATGG + Intergenic
966492999 3:180550139-180550161 CTGTAGCAGTTGAGCACTATTGG - Intergenic
967549523 3:190774209-190774231 CTGGCACAGTTCAGTGCTGAGGG - Intergenic
972515972 4:39810946-39810968 CTGGAACAATTGAGTCCTGTGGG - Intergenic
977247931 4:94655992-94656014 TTGTCACAGTTCACTACTGAAGG - Intronic
981430223 4:144648697-144648719 CTGGAAGAGTTGAGTATTGCAGG - Intronic
984640125 4:182155534-182155556 CTGTGCCAGTTGATTATTGAAGG + Intronic
985055969 4:186035864-186035886 CTTTACCAGTTGATAACTGATGG - Intergenic
985085413 4:186308119-186308141 CTGGAACACTGCAGTACTGAAGG - Intergenic
985669012 5:1196996-1197018 CTGTGGCAGTTGGGTACTGCGGG + Intergenic
985669102 5:1197348-1197370 CTGTGGCAGTTGGGTACTGCAGG + Intergenic
985669125 5:1197475-1197497 CTGTGAGAGTTGGGTACTGTGGG + Intergenic
985669155 5:1197634-1197656 CTGTGAGAGTTGGGTACTGTGGG + Intergenic
986793462 5:11186355-11186377 CAGTAACAGTTGCTTACTGCTGG + Intronic
993913847 5:93717637-93717659 ATGTTACTGATGAGTACTGAAGG + Intronic
994197789 5:96938539-96938561 CTGGAATAGATGAGTATTGAAGG - Intronic
994939380 5:106302015-106302037 CTGTAACATTAGAGTCCAGATGG - Intergenic
998343842 5:141442901-141442923 ATGAAACAGTTGTGTGCTGAAGG - Intronic
1004860682 6:19801759-19801781 CTGTTACTGTTGAGTTTTGAAGG - Intergenic
1007699145 6:43755854-43755876 TTGTAACAGTTGGGGATTGATGG + Intergenic
1009464465 6:63952903-63952925 CTGTAACAGGTGAGTGATAATGG - Intronic
1009508426 6:64516668-64516690 CTGTTACAGTAGAGCACTGAGGG + Intronic
1010083542 6:71888992-71889014 CTGTAACCAGTGAGTACAGACGG - Intronic
1010807762 6:80259049-80259071 CTGAAACAGTTCAGTATTGAAGG + Intronic
1011314823 6:86019624-86019646 CTGAAACAGATCAGGACTGATGG - Intergenic
1012666655 6:101979421-101979443 CTTTAACAGATAAGTCCTGAAGG - Intronic
1015675135 6:135737478-135737500 CTGTTACAGTTGACTACTGATGG + Intergenic
1015794394 6:136996696-136996718 CTGAGACAGATGAGCACTGATGG - Intergenic
1016609242 6:145969836-145969858 ATGTAACAGTTGGGTATGGAGGG - Intergenic
1020794346 7:12662559-12662581 CTGTAACAGGTGAGTGATAATGG - Intergenic
1020805218 7:12781506-12781528 CTGTAACACTAGATTATTGATGG - Intergenic
1022438063 7:30408984-30409006 ATGTATCAGTGGAGTACTGGTGG + Intronic
1022627696 7:32054922-32054944 ATGTTTCAGTTGAGAACTGAAGG - Intronic
1024668111 7:51565784-51565806 CTGCAACAGTGGAGTCCTCATGG + Intergenic
1032144119 7:129363368-129363390 CTATTACATTTGAGAACTGAAGG - Intronic
1038389302 8:27180234-27180256 CTGTAACAGCTGAGTGATGTTGG - Intergenic
1044927792 8:97224081-97224103 CTGTAACACTGGGATACTGAGGG - Intergenic
1046287711 8:112116423-112116445 CTGTTACAGTTGAGAACATATGG - Intergenic
1058925251 9:109656710-109656732 CTGTTGCAGGTGAGAACTGAAGG + Intronic
1185741755 X:2539065-2539087 CTGTGACAGTTGACTCCGGATGG - Intergenic
1185789975 X:2921822-2921844 CTGTAACAGTTGAGTACTGATGG - Intronic
1191014055 X:55791020-55791042 CTGTAACAGGTGAGTGATAACGG + Intergenic
1193767772 X:85551719-85551741 TTGTAACATTTGTGTACTGCTGG - Intergenic
1194033034 X:88839251-88839273 ATTTAACAGATGACTACTGAGGG + Intergenic
1195451945 X:105024528-105024550 CAGAAACAGGTGAGGACTGATGG + Intronic
1195672786 X:107483739-107483761 CTGTGACAGCTGATTACAGAGGG - Intergenic
1196310776 X:114162507-114162529 CTGTAACTGCTGAGGACTCACGG + Intergenic
1197527670 X:127582585-127582607 TTGGAACCGTTGAGGACTGAGGG - Intergenic
1197990455 X:132311712-132311734 CTCTAACTCTTGAGAACTGAAGG - Intergenic
1201284337 Y:12366120-12366142 CTGTAACAGTTGAGTACTGATGG + Intergenic