ID: 1185791643

View in Genome Browser
Species Human (GRCh38)
Location X:2931932-2931954
Sequence TTCTTTTCTCTCTAGTTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185791643_1185791649 25 Left 1185791643 X:2931932-2931954 CCTGAGAACTAGAGAGAAAAGAA No data
Right 1185791649 X:2931980-2932002 GTAAACACACTGAGCTGTCTTGG No data
1185791643_1185791646 -6 Left 1185791643 X:2931932-2931954 CCTGAGAACTAGAGAGAAAAGAA No data
Right 1185791646 X:2931949-2931971 AAAGAACTTTGGGTGCCCTTAGG No data
1185791643_1185791650 26 Left 1185791643 X:2931932-2931954 CCTGAGAACTAGAGAGAAAAGAA No data
Right 1185791650 X:2931981-2932003 TAAACACACTGAGCTGTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185791643 Original CRISPR TTCTTTTCTCTCTAGTTCTC AGG (reversed) Intergenic
No off target data available for this crispr