ID: 1185791647

View in Genome Browser
Species Human (GRCh38)
Location X:2931964-2931986
Sequence TGTTTACATAATTTACCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185791647_1185791660 23 Left 1185791647 X:2931964-2931986 CCCTTAGGTAAATTATGTAAACA No data
Right 1185791660 X:2932010-2932032 GGATTTGGAAATGGGGCCTGGGG No data
1185791647_1185791649 -7 Left 1185791647 X:2931964-2931986 CCCTTAGGTAAATTATGTAAACA No data
Right 1185791649 X:2931980-2932002 GTAAACACACTGAGCTGTCTTGG No data
1185791647_1185791651 2 Left 1185791647 X:2931964-2931986 CCCTTAGGTAAATTATGTAAACA No data
Right 1185791651 X:2931989-2932011 CTGAGCTGTCTTGGGTGCCCAGG No data
1185791647_1185791654 15 Left 1185791647 X:2931964-2931986 CCCTTAGGTAAATTATGTAAACA No data
Right 1185791654 X:2932002-2932024 GGTGCCCAGGATTTGGAAATGGG No data
1185791647_1185791659 22 Left 1185791647 X:2931964-2931986 CCCTTAGGTAAATTATGTAAACA No data
Right 1185791659 X:2932009-2932031 AGGATTTGGAAATGGGGCCTGGG No data
1185791647_1185791655 16 Left 1185791647 X:2931964-2931986 CCCTTAGGTAAATTATGTAAACA No data
Right 1185791655 X:2932003-2932025 GTGCCCAGGATTTGGAAATGGGG No data
1185791647_1185791652 8 Left 1185791647 X:2931964-2931986 CCCTTAGGTAAATTATGTAAACA No data
Right 1185791652 X:2931995-2932017 TGTCTTGGGTGCCCAGGATTTGG No data
1185791647_1185791661 24 Left 1185791647 X:2931964-2931986 CCCTTAGGTAAATTATGTAAACA No data
Right 1185791661 X:2932011-2932033 GATTTGGAAATGGGGCCTGGGGG No data
1185791647_1185791653 14 Left 1185791647 X:2931964-2931986 CCCTTAGGTAAATTATGTAAACA No data
Right 1185791653 X:2932001-2932023 GGGTGCCCAGGATTTGGAAATGG No data
1185791647_1185791658 21 Left 1185791647 X:2931964-2931986 CCCTTAGGTAAATTATGTAAACA No data
Right 1185791658 X:2932008-2932030 CAGGATTTGGAAATGGGGCCTGG No data
1185791647_1185791650 -6 Left 1185791647 X:2931964-2931986 CCCTTAGGTAAATTATGTAAACA No data
Right 1185791650 X:2931981-2932003 TAAACACACTGAGCTGTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185791647 Original CRISPR TGTTTACATAATTTACCTAA GGG (reversed) Intergenic
No off target data available for this crispr