ID: 1185791650

View in Genome Browser
Species Human (GRCh38)
Location X:2931981-2932003
Sequence TAAACACACTGAGCTGTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185791647_1185791650 -6 Left 1185791647 X:2931964-2931986 CCCTTAGGTAAATTATGTAAACA No data
Right 1185791650 X:2931981-2932003 TAAACACACTGAGCTGTCTTGGG No data
1185791643_1185791650 26 Left 1185791643 X:2931932-2931954 CCTGAGAACTAGAGAGAAAAGAA No data
Right 1185791650 X:2931981-2932003 TAAACACACTGAGCTGTCTTGGG No data
1185791648_1185791650 -7 Left 1185791648 X:2931965-2931987 CCTTAGGTAAATTATGTAAACAC No data
Right 1185791650 X:2931981-2932003 TAAACACACTGAGCTGTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185791650 Original CRISPR TAAACACACTGAGCTGTCTT GGG Intergenic
No off target data available for this crispr