ID: 1185793471

View in Genome Browser
Species Human (GRCh38)
Location X:2945250-2945272
Sequence CCACGTGGCCAGAATGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185793466_1185793471 16 Left 1185793466 X:2945211-2945233 CCCTGACAGGGGACAAATGTGAA 0: 1
1: 0
2: 1
3: 9
4: 177
Right 1185793471 X:2945250-2945272 CCACGTGGCCAGAATGCAGCAGG 0: 1
1: 0
2: 1
3: 15
4: 146
1185793467_1185793471 15 Left 1185793467 X:2945212-2945234 CCTGACAGGGGACAAATGTGAAA 0: 1
1: 0
2: 0
3: 12
4: 198
Right 1185793471 X:2945250-2945272 CCACGTGGCCAGAATGCAGCAGG 0: 1
1: 0
2: 1
3: 15
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185793471 Original CRISPR CCACGTGGCCAGAATGCAGC AGG Intronic
901194430 1:7432571-7432593 CCACGGGGCCAGGATGCTGAGGG + Intronic
903755439 1:25657359-25657381 CAGCCTGGCCAGGATGCAGCTGG + Intronic
904714677 1:32458383-32458405 CCACGTGGTCAGGAGGCATCTGG - Intergenic
904772934 1:32890960-32890982 CCAGGTGGCCAGAATGGTGGAGG + Intronic
905454386 1:38077814-38077836 CCACCTGGCCACAAGGAAGCTGG - Intergenic
906909113 1:49927081-49927103 CAATGTGGCCAGAATGTTGCAGG - Intronic
914990761 1:152497810-152497832 CCACATGGCTAGAAAGTAGCAGG - Intergenic
915722473 1:157994594-157994616 CCAAGGGTCCAGACTGCAGCAGG + Intronic
919736743 1:200957342-200957364 CCAGTTTGCCAGAATGCAGGTGG - Intergenic
919919692 1:202160678-202160700 ACAGGAGGGCAGAATGCAGCTGG - Exonic
920387611 1:205579889-205579911 CACCGTGGCCAACATGCAGCTGG + Exonic
923163346 1:231337139-231337161 CCACATGGCCCAACTGCAGCGGG - Exonic
923374216 1:233343970-233343992 CCACGAGGCTCTAATGCAGCTGG - Intronic
1063884029 10:10559807-10559829 TCACATGGGGAGAATGCAGCAGG - Intergenic
1067169417 10:43894275-43894297 CAACGTGGCTAGAATAAAGCAGG - Intergenic
1069717465 10:70530159-70530181 CCACCTCTCCAGCATGCAGCAGG - Intronic
1072781325 10:98253704-98253726 CCTCGTGGGCACAATACAGCTGG + Exonic
1073272838 10:102280796-102280818 CCATGTGGCAGGAGTGCAGCTGG + Intronic
1075483083 10:122798920-122798942 CCACGTGGTCTGCAGGCAGCTGG + Intergenic
1076694591 10:132240989-132241011 CCACTCGGCCAGAATGCTGCAGG - Intronic
1077306555 11:1871249-1871271 CCACGCCGCCGGGATGCAGCAGG + Intronic
1084179370 11:67438808-67438830 CTACGTGCCCAGCAAGCAGCGGG - Exonic
1085020751 11:73205333-73205355 CCAGGTGCCCAGAATACAGCAGG - Intergenic
1090436309 11:126689525-126689547 CCAGGTGACAAGAAGGCAGCTGG - Intronic
1091288889 11:134425830-134425852 CCCCGTGGCCAGGCTGCAACAGG + Intergenic
1091346420 11:134857208-134857230 CAACCTGGCCAGAAAGCAGGAGG + Intergenic
1091835387 12:3582183-3582205 TCACGGGGCCAGCAAGCAGCAGG + Intronic
1094058539 12:26289759-26289781 CCAAGAGGACAGAATCCAGCAGG - Intronic
1104642736 12:130477880-130477902 CCCTGTGGCCAGAGTGCAGCTGG - Intronic
1104672005 12:130686866-130686888 CTACGAGCCCAGAAGGCAGCGGG + Intronic
1104996544 12:132661350-132661372 CCACAGAGCCAGAATACAGCAGG + Intronic
1105284514 13:18993454-18993476 CCAGGAGGCCAGAAGGCAGAAGG + Intergenic
1105284961 13:18996109-18996131 CCCGGAGGCCAGAATGCAGAAGG + Intergenic
1105285071 13:18996737-18996759 CCACATGGCCAGAAAGCAGAAGG + Intergenic
1105602352 13:21898629-21898651 CCACTGTGACAGAATGCAGCAGG + Intergenic
1106340826 13:28824987-28825009 CCACCTGACCAGAGTGCAGCTGG + Intronic
1109638401 13:65153484-65153506 CCAGGTGGTCAGGGTGCAGCTGG + Intergenic
1112524702 13:100133809-100133831 CAGCGTGGCTAGAATGAAGCAGG + Intronic
1112640407 13:101267630-101267652 CCACCTGGCCACCATGCAACAGG - Intronic
1114864455 14:26571593-26571615 CCACGTGGCTAGAACACAGAGGG + Intronic
1117696087 14:58364520-58364542 TCATTTGGCCAGAATGAAGCAGG + Exonic
1118842069 14:69520929-69520951 CCACATGGCCACAGTGCACCTGG - Intronic
1123029646 14:105445593-105445615 CCACGAGGCCAGGATGCCGATGG - Intronic
1124048946 15:26177221-26177243 CGTCATGGCCAGAGTGCAGCCGG + Intergenic
1125456892 15:39869097-39869119 CCACTTGAACAGAATGCAGAGGG - Intronic
1126450140 15:48798472-48798494 TCACCTGGCCAGAGTGCATCTGG - Intronic
1127309123 15:57736833-57736855 CCATCGGGCCAGAATGCAGAAGG - Intronic
1129894003 15:79090462-79090484 CGACGTGGCCATCATTCAGCCGG + Exonic
1132657448 16:1047136-1047158 CCACGTGGCCAGGGTGTGGCAGG + Intergenic
1132950749 16:2560905-2560927 CCACCTGCCCGGGATGCAGCAGG - Intronic
1132963601 16:2639265-2639287 CCACCTGCCCGGGATGCAGCAGG + Intergenic
1133661117 16:7918818-7918840 CCACATGGAGAGAACGCAGCCGG - Intergenic
1138475702 16:57269570-57269592 CCACGAGGCAGGAAGGCAGCCGG + Intronic
1139962283 16:70724909-70724931 CCACCTACCCAGAATGCAGATGG - Intronic
1141624781 16:85255316-85255338 CCACACAGCCAGAAGGCAGCGGG - Intergenic
1142089971 16:88204617-88204639 CGCCTTGGCCAGAATGCAGGAGG + Intergenic
1148821384 17:50361727-50361749 CCACCAGGCCAGGCTGCAGCAGG + Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151258453 17:72898080-72898102 CCAAGTGAACTGAATGCAGCAGG + Intronic
1151870320 17:76832402-76832424 CAACGTGGCTAGAATAAAGCAGG - Intergenic
1152237608 17:79146746-79146768 CCACGTGACCAGCAGGCTGCAGG - Intronic
1152700335 17:81815352-81815374 CCACAGGGCCTGCATGCAGCAGG + Intergenic
1153997677 18:10455425-10455447 CCAAAATGCCAGAATGCAGCAGG + Intronic
1154383892 18:13876184-13876206 ACACGTGGCCAGCATTCTGCTGG - Intergenic
1156332715 18:36139595-36139617 TCACTTGGCCTGAATGCAGATGG - Exonic
1160168409 18:76532512-76532534 CCACCTGCCCAGAATCCACCTGG - Intergenic
1161078629 19:2299372-2299394 CCATGTGCCCTGAATGCATCCGG + Intronic
1161496047 19:4586408-4586430 CCACCTCCCCAGTATGCAGCAGG + Intergenic
1161702024 19:5800834-5800856 CCACGTGGGCAGAGAGCAGGTGG + Intergenic
1162777362 19:12987925-12987947 CTACCTGGCCAGGATGCTGCGGG - Intergenic
1166323552 19:42034912-42034934 CCTAGTGGCCAGGATGCAGTGGG + Intronic
1167245625 19:48371394-48371416 CCAGATGGTCACAATGCAGCAGG - Intronic
1167286847 19:48603303-48603325 CCACCTGCCCAAAATGCAGCAGG + Intronic
1167405187 19:49302044-49302066 CTCTGTGGCCAGACTGCAGCAGG + Intronic
1168058055 19:53874459-53874481 CCAGGTGGGCAGAGTGCACCAGG - Exonic
925639999 2:5978302-5978324 CCACGTTGCCAGAATGCCTGGGG + Intergenic
926087972 2:10032101-10032123 CCCTGTGGCCAGTCTGCAGCCGG - Intergenic
927213628 2:20653493-20653515 CCACCTGTCAAGAATGCAACTGG + Intergenic
927542796 2:23927412-23927434 CCCCGTGGCCTGGATGGAGCAGG + Intronic
933777470 2:85779685-85779707 CCACATTGCTAGGATGCAGCAGG - Intronic
936038886 2:109134096-109134118 CAAAGTGCCCAGCATGCAGCAGG - Intronic
938246227 2:129779922-129779944 GCACGGGGCCAGACTGGAGCAGG - Intergenic
947531621 2:230912224-230912246 CCACTTCGGCAGAAAGCAGCTGG + Intronic
947921049 2:233874569-233874591 CAGCGTGGCCAGAATAAAGCAGG + Intergenic
1168771391 20:419197-419219 CCACTTGGCCAGATGGAAGCTGG + Intronic
1170745965 20:19099168-19099190 CCACCTGCCCCGAAGGCAGCAGG - Intergenic
1171869179 20:30512495-30512517 ACACCCGGCCAGCATGCAGCTGG + Intergenic
1172987832 20:39007264-39007286 CACCGTGGCCAGCATACAGCAGG - Intronic
1174379831 20:50149405-50149427 ACACATGGCCAGATTTCAGCTGG + Intronic
1175313586 20:58028862-58028884 CCCAATGGCCAGCATGCAGCAGG + Intergenic
1175367919 20:58467987-58468009 CCAGGTGCCCAGAGTCCAGCGGG - Intronic
1178809384 21:35867520-35867542 CCCTGTGGGGAGAATGCAGCGGG + Intronic
1181914925 22:26272463-26272485 CCACTGGGCCAGGCTGCAGCTGG + Intronic
1181918438 22:26299504-26299526 CCACAGAGACAGAATGCAGCCGG - Intronic
1183508331 22:38221377-38221399 CCACCAGGCCAGGAGGCAGCTGG - Exonic
1184604239 22:45563050-45563072 CCCCGGGGACAGCATGCAGCTGG + Intronic
949954530 3:9256761-9256783 CCACAGGGGCAGAATGCAGGCGG - Intronic
953232907 3:41080274-41080296 CCTGATGTCCAGAATGCAGCTGG - Intergenic
961511574 3:127406950-127406972 CCACGGAGGCAGAATGCAGCTGG + Intergenic
961608081 3:128112507-128112529 CCATGTGGCCAGAATGCCCCTGG - Intronic
961772098 3:129257589-129257611 CCGGGTGGCCAGCAAGCAGCTGG + Exonic
962428888 3:135301360-135301382 CCACGTGGCCAGGAAGGATCTGG + Intergenic
962660210 3:137594575-137594597 CCTCATGGCCAGAATGAAGAAGG - Intergenic
963254878 3:143134820-143134842 CCACATGGCTAAAATGCTGCAGG - Intergenic
967035907 3:185648043-185648065 CCCCGTCTCCAGAATGCAGTCGG - Intronic
968318944 3:197748965-197748987 CTAGGTGGACAGAATGCATCTGG + Intronic
968800626 4:2741257-2741279 CAGCGTGGCCAGAATAAAGCAGG + Intergenic
969513309 4:7631934-7631956 GCACCTGCCCAGAAGGCAGCTGG - Intronic
971102743 4:23485895-23485917 CCACTTGGCCAGAAGGAAGCAGG - Intergenic
975573394 4:75839984-75840006 GCACGTGGGCAGAATGGACCTGG + Intergenic
977656732 4:99530915-99530937 CAAAGTGGCCAGAGTGTAGCAGG - Intronic
982522763 4:156440034-156440056 CCAAGTGGAGAAAATGCAGCAGG + Intergenic
982856255 4:160385810-160385832 CCAGGTGCCATGAATGCAGCAGG - Intergenic
986801713 5:11267238-11267260 CCACGTGGGGAGAATCCATCAGG - Intronic
991945600 5:71895782-71895804 CCACATGGCCAGAATAAGGCAGG - Intergenic
996479087 5:123952978-123953000 CCAGGTGGGCAGTATGCAGTGGG + Intergenic
996573785 5:124960809-124960831 TCACGTGGCCAGAATGAAGTAGG - Intergenic
999968604 5:156836112-156836134 CCTAGTGGCCATAATGAAGCAGG - Intergenic
1002423992 5:179165192-179165214 CCACCTGGCCTGCATGCAGGAGG + Intronic
1002635918 5:180608759-180608781 CCACGTGGCCAGCATGTGACAGG + Intronic
1003383409 6:5645741-5645763 CCACGTCAACTGAATGCAGCCGG - Intronic
1004015549 6:11728724-11728746 CCAAGTGCCCAAAATGCAGCAGG + Intronic
1006009675 6:31032009-31032031 CCATGTCCCCAGAATGCAGGTGG - Intronic
1006572545 6:35017660-35017682 CCACAAGGCCAGCATGCAGCTGG + Exonic
1011433618 6:87314628-87314650 CCACTTGCCCAGAATGAAGGTGG - Intronic
1015218789 6:130780828-130780850 CCACCTTGCCAGATTCCAGCAGG + Intergenic
1015878069 6:137844377-137844399 CCCCGTGGCCAGGATCCAACAGG - Intergenic
1017274758 6:152553460-152553482 CGATATGGCCAGAATCCAGCTGG + Intronic
1019368947 7:650796-650818 TCACGTGGCCAGCAGGCAGCAGG + Intronic
1021924208 7:25519240-25519262 CCACTTGGCCTTAATGCTGCTGG - Intergenic
1021938635 7:25656433-25656455 CCACCTGTACAGAATGCACCAGG + Intergenic
1023632227 7:42176244-42176266 CCAAGATGCCAGAAGGCAGCTGG + Intronic
1023833986 7:44057871-44057893 CCACGTGCCCAGCATGCCCCGGG - Intronic
1029468336 7:100740139-100740161 CCATGTGGCCAGCATGAAGAGGG + Intronic
1029804819 7:102985220-102985242 CCACCTGGCCAGCATGCATCTGG + Intronic
1030532695 7:110730270-110730292 CAACGTGGCTAGAATAAAGCAGG + Intronic
1031085473 7:117298042-117298064 CCACCTGCCCTGACTGCAGCAGG + Intronic
1032177495 7:129643534-129643556 CAACTGGGTCAGAATGCAGCTGG - Intronic
1032528733 7:132602427-132602449 CCACGGGGCCATAAAGGAGCTGG - Intronic
1036755803 8:11470398-11470420 CCTCGAGGCCAGAATGCAGCAGG + Intronic
1037644073 8:20774355-20774377 CCAAGCTCCCAGAATGCAGCGGG - Intergenic
1039559788 8:38503857-38503879 GCACGTGGCCTGAGTGGAGCGGG - Intergenic
1046680371 8:117162982-117163004 GCATGTGGCCAGCATACAGCTGG - Intronic
1047446758 8:124927054-124927076 GCACGTGGCCAGAACCCAGAGGG + Intergenic
1048352365 8:133626492-133626514 CCACGTGGCCAGAGGGGAGTAGG + Intergenic
1049344711 8:142132626-142132648 TCCCGGGGCCAGACTGCAGCTGG - Intergenic
1049379972 8:142307270-142307292 CCCCGTGGCATGAATTCAGCAGG + Intronic
1049726272 8:144147965-144147987 GCGGGTGGCCAGAAGGCAGCGGG + Intergenic
1049755221 8:144308522-144308544 AAACGTGGCCAGAGTGCGGCGGG + Intronic
1055512798 9:77012105-77012127 CCTCGTTGCCAAAGTGCAGCGGG + Intergenic
1059323283 9:113485749-113485771 CCAGGTGGCCAGCATACACCAGG + Intronic
1060738770 9:126083890-126083912 CCAAGTGGCCAGAAAGAAGAAGG - Intergenic
1060831698 9:126721712-126721734 CCTGGTGGCAAGATTGCAGCTGG - Intergenic
1060968926 9:127727038-127727060 CCACCTGGCCAGGCTGCAGCTGG + Exonic
1061071173 9:128311578-128311600 CCACGTGACCAGAGAGAAGCTGG - Exonic
1061194678 9:129101212-129101234 CCACGTTGAGAGGATGCAGCGGG + Intronic
1061448351 9:130654858-130654880 CCTCATGGCCAGAACCCAGCTGG + Intergenic
1061550422 9:131331362-131331384 CCACTTGGCCGGAAAGCGGCAGG + Intergenic
1061990664 9:134157000-134157022 CCACTAGGCCTGCATGCAGCTGG - Intronic
1185793471 X:2945250-2945272 CCACGTGGCCAGAATGCAGCAGG + Intronic
1191870051 X:65738230-65738252 CCTCTTGGCAAGTATGCAGCTGG - Intronic
1198019175 X:132641809-132641831 ACAACTGGCCTGAATGCAGCAGG + Intronic
1200146432 X:153928539-153928561 GCACGTGACCAGCAGGCAGCCGG - Intronic