ID: 1185798968

View in Genome Browser
Species Human (GRCh38)
Location X:2992151-2992173
Sequence ATTACATTTCTCCACGTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185798967_1185798968 -4 Left 1185798967 X:2992132-2992154 CCAGTGAAAAGTGTGACAAATTA No data
Right 1185798968 X:2992151-2992173 ATTACATTTCTCCACGTTAAAGG No data
1185798966_1185798968 17 Left 1185798966 X:2992111-2992133 CCAAGAAAGGAAGAAGAAATTCC No data
Right 1185798968 X:2992151-2992173 ATTACATTTCTCCACGTTAAAGG No data
1185798965_1185798968 23 Left 1185798965 X:2992105-2992127 CCTGAGCCAAGAAAGGAAGAAGA No data
Right 1185798968 X:2992151-2992173 ATTACATTTCTCCACGTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185798968 Original CRISPR ATTACATTTCTCCACGTTAA AGG Intergenic