ID: 1185801799

View in Genome Browser
Species Human (GRCh38)
Location X:3017801-3017823
Sequence GACTCAGATGTGCCACAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 125}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185801799 Original CRISPR GACTCAGATGTGCCACAGTA AGG (reversed) Intronic
901186687 1:7378100-7378122 GACTCAGATGTGTCTGAGTGAGG - Intronic
904860912 1:33537050-33537072 GACCCTGGTGTGCCACAGTTTGG - Exonic
906021323 1:42631968-42631990 GTATCAGCTTTGCCACAGTAGGG - Intronic
906510426 1:46407525-46407547 GTCTCAGATGCCCCGCAGTAGGG - Intronic
915565327 1:156709769-156709791 GAGGCAGATGTGGCCCAGTAGGG + Intergenic
1067522458 10:47018268-47018290 GACCCAGACATGCCACAGTTGGG + Intergenic
1069825263 10:71251015-71251037 GACTCAGATCTGGCTCAGTTGGG + Intronic
1070641074 10:78170600-78170622 GACTCAGATTGGGCACAGAAGGG + Intergenic
1071137015 10:82465105-82465127 CACTCTGGTGTGCCACTGTAGGG - Intronic
1072590858 10:96827367-96827389 GAGTCAGCTGCTCCACAGTAGGG + Intergenic
1073050445 10:100663605-100663627 GACTCAGATGTGCCAAAAGCAGG + Intergenic
1074390110 10:113049995-113050017 GGCTCAGATGTGGCACAGTTGGG - Intronic
1075833202 10:125428548-125428570 GACTCAGATGTCCCACAGTGGGG + Intergenic
1076333724 10:129691231-129691253 GACACAGCTGTGCCACACTGGGG - Intronic
1076364428 10:129912796-129912818 CACTCTGATGCGCCACAGCAAGG + Intronic
1081628936 11:44674352-44674374 GTCACATATGTACCACAGTAAGG + Intergenic
1082251392 11:49984948-49984970 GACTCAGCAGTGCCAGAGTTTGG + Intergenic
1083386039 11:62311100-62311122 GACTCAGATGAGCTACTGTGTGG - Intergenic
1084426656 11:69087723-69087745 GACTCAGATGAGCCTCAGGATGG - Intronic
1085805033 11:79627923-79627945 GACTCAGATGTGACTTTGTAAGG - Intergenic
1091792654 12:3280640-3280662 GAGTCAGATGTGATACAGCAAGG + Intronic
1092961563 12:13601393-13601415 GACACAGATTTGACACAGAAGGG - Intronic
1098289135 12:68938467-68938489 GAAACAAATGTGCCACATTAGGG - Intronic
1098843033 12:75500300-75500322 GACTCAGAAGTTCCAAAATATGG - Exonic
1100054350 12:90490896-90490918 GATTTACATGTGCCCCAGTAGGG - Intergenic
1100700661 12:97144387-97144409 AAATCAGATGTGCCACATTAGGG - Intergenic
1101415416 12:104504389-104504411 GACTCAGCAGTGCCAGAGTCAGG - Intronic
1101779098 12:107819558-107819580 GATTATGATGTGCCTCAGTATGG - Intergenic
1107039420 13:35933364-35933386 CACTAAGCAGTGCCACAGTAAGG + Intronic
1112846749 13:103653066-103653088 GATTAAGGTGTGCCACATTATGG + Intergenic
1112846766 13:103653163-103653185 GATTAAGCTGTGCCACATTATGG + Intergenic
1115495788 14:34003252-34003274 GACTTAGAGCTGACACAGTACGG + Intronic
1115977542 14:39013358-39013380 CACTCACATGTACCAGAGTATGG + Intergenic
1116638630 14:47431842-47431864 GTCTAAAAAGTGCCACAGTAAGG + Intronic
1118445405 14:65846649-65846671 GATTCTGATTTGCCACAGAATGG + Intergenic
1119693500 14:76694897-76694919 CACACAGATGTACCACAGTCGGG + Intergenic
1121121552 14:91378998-91379020 AAATCAGCTGGGCCACAGTACGG + Intronic
1121723671 14:96130433-96130455 GTCTCAGTTGTACCACAGTGTGG - Intergenic
1122089713 14:99330295-99330317 GACTCAGATGGCCCTCAGCACGG - Intergenic
1126655357 15:50971403-50971425 GACTAAAATGTGCCACAAAAAGG + Intronic
1134260049 16:12643831-12643853 ACCTAAGATGTTCCACAGTAAGG - Intergenic
1134409894 16:13995164-13995186 GACTCAGATGTCCCCCAGTAAGG + Intergenic
1135129538 16:19841255-19841277 TACTCAGATCTGGCAAAGTAAGG - Intronic
1138109897 16:54315462-54315484 GACTCGGATGTGGCACAGCTGGG - Intergenic
1143296012 17:5872712-5872734 GACCCAGATGTTCCCCAGCAGGG + Intronic
1144369072 17:14572822-14572844 CACTCAGAAGTGGCACAGTATGG - Intergenic
1144767850 17:17742666-17742688 GACTCAGGTGTGGGACAGCATGG - Intronic
1145061713 17:19738173-19738195 CACTCCGATGGGACACAGTATGG + Exonic
1145967460 17:28930131-28930153 GACACAGATGAGAAACAGTATGG - Intronic
1155334489 18:24750301-24750323 GGCCCACATGTGCCAAAGTAGGG - Intergenic
1156344979 18:36248965-36248987 GACTCAGATTCGCCAAAGCAGGG + Exonic
1159924999 18:74261451-74261473 GAAGCAGAAGTGCCACAGTCAGG + Intronic
1160895531 19:1400341-1400363 GAGTCACATTTGCCACAGGACGG + Intronic
1160979768 19:1811627-1811649 GACTCAGACGTGACTCAGGAAGG - Exonic
1163790039 19:19301268-19301290 GATTCAGGTGTGCCCCAGTCTGG - Intronic
1164546398 19:29168103-29168125 GACTCAGAAATTCCACAGCAAGG + Intergenic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
925464890 2:4098355-4098377 GGCACAGATGTTCCACAGCAGGG - Intergenic
926158894 2:10474383-10474405 GACACAGATGTGCCAGAGAGAGG + Intergenic
926379301 2:12268830-12268852 CACTCAGATGAGCAACAATAAGG + Intergenic
929743986 2:44636359-44636381 GACCCAGATGTGCAAGAGTTTGG + Intronic
932231086 2:70085245-70085267 GGCTCAAATGTGCCACAGACAGG + Intergenic
933596894 2:84291378-84291400 CACTCGGATTTGCCACAGCAGGG - Intergenic
933984685 2:87580812-87580834 GACTCAGTTCTGCCACTGTCTGG + Intergenic
935856411 2:107279295-107279317 GACACAGATGTGCCTCATCATGG + Intergenic
936309166 2:111369988-111370010 GACTCAGTTCTGCCACTGTCTGG - Intergenic
936781931 2:116043782-116043804 GACTCAGATGTACAACAGTTAGG + Intergenic
937394939 2:121526378-121526400 GGCTCAGATGTGCCCCAGTAGGG - Intronic
937394945 2:121526409-121526431 AACTCAAATGTGCCCCAGTAGGG - Intronic
937825453 2:126364234-126364256 GACACAGATGTGCCCCACAATGG + Intergenic
938453520 2:131444048-131444070 CACGCTGATGTGCCACAGCACGG + Intergenic
941425316 2:165337516-165337538 GACTAAGATGTGCCTAAGTATGG - Intronic
941930336 2:170932294-170932316 GACTGAGGTGTGCAACAGCATGG - Intronic
948391672 2:237615970-237615992 GACTAAGATGTGCCAGTGTCTGG - Intergenic
948581837 2:238992494-238992516 AACTGAGATGGGCCACAGTGAGG + Intergenic
948603036 2:239118151-239118173 GTCTCTGATGTTCCACAGTGAGG - Intronic
1169123888 20:3113499-3113521 GAGTATGATGAGCCACAGTAAGG + Intronic
1172617722 20:36300217-36300239 GGCTCAGATGTGCCCCAGCCTGG + Intergenic
1172667114 20:36607949-36607971 GACCCAGGAGTGCCACTGTAGGG - Intronic
1173646540 20:44636744-44636766 GACCCAGATGTCCCAAACTAGGG + Intronic
1174240910 20:49133803-49133825 TACCCAGGTGGGCCACAGTAGGG + Intronic
1174687319 20:52468392-52468414 GACTCAGATGAAACACAGGAAGG + Intergenic
1176092432 20:63325198-63325220 GACCCAGAGGGGCCACAGGAGGG + Intronic
1177859704 21:26438492-26438514 GTATCAGCTGTGCCACAGTGTGG - Intergenic
1178221859 21:30669360-30669382 CACTCAGTGGTGCCCCAGTAGGG - Intergenic
1178905515 21:36632921-36632943 ATCTCAGAAGTGCCACAGAAGGG + Intergenic
951681332 3:25297999-25298021 GATTCAGATATTCCACAGAAAGG + Intronic
955465226 3:59230229-59230251 CACTCAGTGGTGCCCCAGTAGGG + Intergenic
959830132 3:110851439-110851461 GACTGTGATGTGCATCAGTATGG + Intergenic
960814610 3:121659862-121659884 GCCTCAGAGGAGCCACAGGAAGG - Intronic
961636110 3:128334143-128334165 GACTCAGATGTGGCAGAGGCAGG - Intronic
968597212 4:1491717-1491739 GACTCAGCTGTGCCACCATCAGG + Intergenic
978697708 4:111602627-111602649 GACTCAGATATTCTACAGTAGGG - Intergenic
978991276 4:115084891-115084913 CACTAAGCAGTGCCACAGTAGGG - Intronic
981303810 4:143224012-143224034 AACTAAGAAGTGCAACAGTAAGG + Intergenic
982677968 4:158397935-158397957 GATTCATAAGTGCCTCAGTAAGG - Intronic
985305884 4:188539072-188539094 GACTCAGCTGTTCCACAATTAGG - Intergenic
985754493 5:1704964-1704986 GACTCAGATCTGCAACAGAGGGG - Intergenic
986223648 5:5793154-5793176 GCCCCAGATGTTCCACAGCAAGG + Intergenic
988762866 5:34333140-34333162 GACTCAGCTGTGTTACATTACGG - Intergenic
994755599 5:103790297-103790319 GACTAGGCAGTGCCACAGTAGGG + Intergenic
995804789 5:116039118-116039140 GACTCAGTTGTACCCCAGGAGGG + Intronic
1005551470 6:26922168-26922190 AACTCTGATGTGCTACAGCACGG + Intergenic
1005807557 6:29488635-29488657 GATGCAGCAGTGCCACAGTATGG + Intergenic
1006824799 6:36926887-36926909 GACTCAGATGTGCCTCCGTTGGG + Intronic
1008102012 6:47401738-47401760 GTGTCAGATGTGCCGCAGGATGG - Intergenic
1008761485 6:54857296-54857318 GACTCAGAGGTGGGACAGGAGGG + Intronic
1009274646 6:61660065-61660087 CTCTCAGATGTGTCCCAGTAGGG - Intergenic
1009736561 6:67684106-67684128 GACTCAGTGGTGACACACTATGG - Intergenic
1012057161 6:94427688-94427710 GATTCTGATGTGTCTCAGTATGG + Intergenic
1012483093 6:99689858-99689880 GTATCAGCTCTGCCACAGTATGG + Intergenic
1014213059 6:118727004-118727026 GACTCAAATGTGCCATGGTTTGG + Intergenic
1014551186 6:122790648-122790670 GACTGACATTTGCCACAGTTCGG - Intronic
1017256967 6:152344212-152344234 GTCTCAGATGTACCAGAGTTTGG - Exonic
1020958815 7:14776796-14776818 CACTAGGTTGTGCCACAGTAGGG - Intronic
1023237350 7:38104093-38104115 GACTCTGGTGTGCCAAAGTGTGG + Intergenic
1023284651 7:38606534-38606556 TTCTGAGACGTGCCACAGTATGG - Intronic
1023576230 7:41630391-41630413 GAATCTGAAGTGCCACACTAAGG + Intergenic
1028451927 7:90994819-90994841 GCCTCAGATGTGTCACACTATGG - Intronic
1028807852 7:95049488-95049510 GAAACAAATGTACCACAGTAAGG - Intronic
1031283948 7:119841370-119841392 CACTAAGCTGTGCCACAGTGAGG - Intergenic
1033881207 7:145886435-145886457 GACACAAAAGTGCCACTGTACGG + Intergenic
1035632299 8:1117303-1117325 CACTCAGAGGTGCCACACTGGGG + Intergenic
1038135371 8:24780148-24780170 GACTGTTATGTGCCACATTAAGG + Intergenic
1038419848 8:27426631-27426653 CACTCAGATGTGCCACAATCTGG - Intronic
1039645348 8:39276715-39276737 GACTCCAACGTGCCACTGTAAGG - Intronic
1045845314 8:106628120-106628142 GACCCACATGTGCCATAATAAGG - Intronic
1047734944 8:127757028-127757050 GACTCAGTGGTGCCCCAGTCAGG + Intergenic
1049198227 8:141326973-141326995 GAGACAGATGTGCCACATGAAGG + Intergenic
1053346745 9:37383698-37383720 TGCCCAGATGTGCAACAGTAGGG - Intergenic
1055026422 9:71727156-71727178 TTCTCACATGAGCCACAGTAAGG + Intronic
1055289391 9:74767125-74767147 GTCACAGATGTTCCTCAGTAAGG + Intronic
1055918121 9:81427928-81427950 GACTTTGATGTGCCACTGTGTGG - Intergenic
1056329686 9:85511141-85511163 GACACAGAGGGGCCACAGTGAGG - Intergenic
1058451657 9:105102005-105102027 GATTCAGTTCTGCCACTGTAGGG - Intergenic
1060362940 9:122977859-122977881 GACTCTCCTGTGCCACTGTATGG - Intronic
1185801799 X:3017801-3017823 GACTCAGATGTGCCACAGTAAGG - Intronic
1190121598 X:47664473-47664495 GACTCTGATGTGCCTCAGCATGG + Intergenic
1194404725 X:93481702-93481724 TACTGATATGTGCCACAATATGG + Intergenic
1199075298 X:143518298-143518320 GACCCACATGTGCACCAGTATGG + Intergenic
1199094283 X:143721547-143721569 GACCCACATGTGCACCAGTATGG + Intergenic