ID: 1185802980

View in Genome Browser
Species Human (GRCh38)
Location X:3030122-3030144
Sequence CCTACCACACAGGTTCACGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185802974_1185802980 -3 Left 1185802974 X:3030102-3030124 CCCGAGAGAAGGGGATATGCCCT No data
Right 1185802980 X:3030122-3030144 CCTACCACACAGGTTCACGGTGG No data
1185802970_1185802980 26 Left 1185802970 X:3030073-3030095 CCATTGCAATATTTTCATGACTT No data
Right 1185802980 X:3030122-3030144 CCTACCACACAGGTTCACGGTGG No data
1185802975_1185802980 -4 Left 1185802975 X:3030103-3030125 CCGAGAGAAGGGGATATGCCCTA No data
Right 1185802980 X:3030122-3030144 CCTACCACACAGGTTCACGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185802980 Original CRISPR CCTACCACACAGGTTCACGG TGG Intronic