ID: 1185809218

View in Genome Browser
Species Human (GRCh38)
Location X:3089553-3089575
Sequence CAGTGAAATCGTCCGTGGTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 31}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185809218_1185809229 22 Left 1185809218 X:3089553-3089575 CCCCACCACGGACGATTTCACTG 0: 1
1: 0
2: 1
3: 5
4: 31
Right 1185809229 X:3089598-3089620 TGGGGATAATGTGGAAGAGATGG 0: 1
1: 0
2: 4
3: 50
4: 516
1185809218_1185809224 2 Left 1185809218 X:3089553-3089575 CCCCACCACGGACGATTTCACTG 0: 1
1: 0
2: 1
3: 5
4: 31
Right 1185809224 X:3089578-3089600 ACCAGCAAGCATGGCTTGTATGG 0: 1
1: 0
2: 0
3: 10
4: 114
1185809218_1185809227 4 Left 1185809218 X:3089553-3089575 CCCCACCACGGACGATTTCACTG 0: 1
1: 0
2: 1
3: 5
4: 31
Right 1185809227 X:3089580-3089602 CAGCAAGCATGGCTTGTATGGGG 0: 1
1: 0
2: 1
3: 9
4: 120
1185809218_1185809226 3 Left 1185809218 X:3089553-3089575 CCCCACCACGGACGATTTCACTG 0: 1
1: 0
2: 1
3: 5
4: 31
Right 1185809226 X:3089579-3089601 CCAGCAAGCATGGCTTGTATGGG 0: 1
1: 0
2: 0
3: 9
4: 102
1185809218_1185809228 13 Left 1185809218 X:3089553-3089575 CCCCACCACGGACGATTTCACTG 0: 1
1: 0
2: 1
3: 5
4: 31
Right 1185809228 X:3089589-3089611 TGGCTTGTATGGGGATAATGTGG 0: 1
1: 0
2: 2
3: 19
4: 162
1185809218_1185809223 -7 Left 1185809218 X:3089553-3089575 CCCCACCACGGACGATTTCACTG 0: 1
1: 0
2: 1
3: 5
4: 31
Right 1185809223 X:3089569-3089591 TTCACTGGCACCAGCAAGCATGG 0: 1
1: 0
2: 0
3: 19
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185809218 Original CRISPR CAGTGAAATCGTCCGTGGTG GGG (reversed) Exonic
1064239214 10:13610092-13610114 CAATGAAATCGTCGGCGGTCAGG + Exonic
1065722200 10:28637559-28637581 CAATGAAATCTTCGCTGGTGTGG - Intergenic
1078773334 11:14371418-14371440 CAGTCAATTTGTCTGTGGTGAGG - Intergenic
1087495733 11:98888642-98888664 CACTGACATCTTCCTTGGTGAGG + Intergenic
1096726386 12:53566466-53566488 CAATGAAATCCACCGTGGTGGGG + Intronic
1097192850 12:57227679-57227701 CAGTAAAATAGTGTGTGGTGGGG + Intergenic
1117539211 14:56730348-56730370 CAGTGGAATTGTCCGAGCTGAGG + Exonic
1137335851 16:47547966-47547988 CAGTGTAAGCATCCGTGGTCAGG - Intronic
1143211544 17:5191784-5191806 CAGTGATAGCGGCCGTGGAGGGG - Intronic
1162282449 19:9710065-9710087 CAGTGAAATATTCCTTGGTGAGG + Intergenic
1163978412 19:20874762-20874784 CAGTGAAATGGTTCCTGCTGTGG - Intergenic
1165926364 19:39328515-39328537 CAGTGAGGTCATCAGTGGTGCGG + Exonic
925381886 2:3433984-3434006 CACTGAAATCCTCCATGCTGAGG - Intronic
927956224 2:27209086-27209108 CTGTGAAATCGTCAGTGGTGGGG - Intronic
930620419 2:53637702-53637724 CAGTGTAATGGTCCATGGAGAGG - Intronic
940533897 2:154913911-154913933 CAGAGAAATGATCAGTGGTGAGG + Intergenic
948598710 2:239096416-239096438 GGGTGCAGTCGTCCGTGGTGGGG - Intronic
1174441292 20:50557098-50557120 CAGAGAAATGGTCTGAGGTGGGG - Intronic
1177877898 21:26656867-26656889 CAATGAAATCTTCAATGGTGTGG - Intergenic
949970040 3:9396913-9396935 CAGTGAAATCGGCTCTGGCGCGG - Intergenic
974248303 4:59351615-59351637 CCTTGAAATTGTCCATGGTGGGG + Intergenic
976404810 4:84651450-84651472 CAGTGAAATCTTCAGGGCTGGGG + Intergenic
991595422 5:68299883-68299905 CAGGGAAATCGTCAGTTGTCTGG - Exonic
995888131 5:116918903-116918925 AAGTCAAATCTTCCCTGGTGAGG + Intergenic
998332962 5:141345731-141345753 CAGTGGAACCGTCTGTGGGGAGG - Exonic
998336372 5:141375781-141375803 CAGTGGAACCGTCTGTGGGGAGG - Exonic
998338390 5:141394511-141394533 CAGTGGAACCGTCTGTGGGGAGG - Exonic
998342749 5:141432457-141432479 CAGTGGAACCGTCCGTGGGGAGG - Exonic
998743946 5:145235517-145235539 CACTCAAATCGTCCCTGGTGGGG + Intergenic
1003137905 6:3446997-3447019 CAGTGAGATCTCGCGTGGTGGGG - Intronic
1004604546 6:17181732-17181754 CAGTGAAATGGCCCTTGGTAGGG - Intergenic
1012166205 6:95955582-95955604 CAGTGAAATGTTCTGTGGTGAGG + Intergenic
1017043774 6:150328312-150328334 CAGTGAATTCGACATTGGTGAGG + Intergenic
1017124555 6:151052951-151052973 CACTGAGATCGCCCGTCGTGGGG + Intronic
1018203466 6:161415772-161415794 CAGTGAAATGGGCAGTGGCGGGG - Intronic
1019454699 7:1120771-1120793 GAGTAAAATAGTCCATGGTGCGG - Intronic
1022028568 7:26470641-26470663 CAGTGAGATCCTCTGTGGGGTGG + Intergenic
1185809218 X:3089553-3089575 CAGTGAAATCGTCCGTGGTGGGG - Exonic