ID: 1185810507

View in Genome Browser
Species Human (GRCh38)
Location X:3104839-3104861
Sequence CTCACTCATCTCTATAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 264}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185810507 Original CRISPR CTCACTCATCTCTATAAGAA AGG Intronic
909455864 1:75847806-75847828 CTCACTCATCACGGTAGGAATGG + Intronic
909502409 1:76349699-76349721 TTGACTCCTCTCTATAAAAAAGG + Intronic
909700080 1:78512583-78512605 CTCACTCATTATTATAAGGAGGG + Intronic
919315334 1:195965707-195965729 CTCACTCATATCAGTAGGAAGGG - Intergenic
922345002 1:224689247-224689269 CTCACACACCTCTATGAGCACGG - Intronic
922366143 1:224865570-224865592 CTCACTCATATCTTTATAAAGGG - Intergenic
923067555 1:230532729-230532751 CTCACTCATCACCAAAAGGATGG - Intergenic
923785411 1:237063104-237063126 CTCTCTCATCTCTCTTATAAAGG - Intronic
924400778 1:243678402-243678424 TTCACTGATCTCTAGAAGAATGG + Intronic
1063301273 10:4851021-4851043 CTCCCTCATCTTTATAACTAAGG - Intergenic
1063766642 10:9149190-9149212 CTCACTGGTCTCTACAAGGAAGG + Intergenic
1066359586 10:34717247-34717269 CTCCCTCATTTCTATACAAAAGG - Intronic
1066521528 10:36225532-36225554 CTTACTCATCCCTAAATGAAAGG + Intergenic
1067139346 10:43643513-43643535 ATCACTCATGTCTATAGCAAGGG - Intergenic
1070580099 10:77712564-77712586 CTTTCTCATCTCTAAAATAATGG - Intergenic
1072233038 10:93429122-93429144 CTCACTCATTACTGCAAGAATGG - Intronic
1072354004 10:94588238-94588260 TTCAGTCTTCTCAATAAGAAAGG - Exonic
1074212084 10:111344483-111344505 CTCACACATCACCATAAGACAGG - Intergenic
1075203985 10:120430997-120431019 CTCACTCCTCTCTTTAAAACTGG + Intergenic
1075625525 10:123961777-123961799 CTCACTCATGTCTGGAACAAAGG + Intergenic
1075975304 10:126689300-126689322 ATCACTCATCCCCATCAGAAAGG - Intergenic
1076118015 10:127914058-127914080 CTCACTCATCACTAAAGGGATGG - Intronic
1079747734 11:24154896-24154918 CTGTCTCTTCTCTATGAGAACGG - Intergenic
1085147091 11:74210556-74210578 CTCACTCATTACCATGAGAACGG - Intronic
1086820881 11:91434382-91434404 CTCACTCATTTCTGTGAGTATGG + Intergenic
1088445933 11:109928523-109928545 CTCACTCATTACCATAAGGATGG - Intergenic
1088880219 11:113967679-113967701 CTCACTCATTACTATGAGCATGG - Intergenic
1089388246 11:118081940-118081962 CTCACTGATGTCCACAAGAAGGG + Intronic
1090441575 11:126729101-126729123 TTCCCTCATCTCTAGCAGAATGG + Intronic
1090903049 11:131049275-131049297 CACACTCATCTTTAAAAGGAAGG - Intergenic
1092117104 12:6017180-6017202 TTTACTCATTTCTAGAAGAATGG - Intronic
1092388494 12:8054234-8054256 CTAACTCATCTCTTTTACAAGGG + Exonic
1092495142 12:8986014-8986036 CACACTCAACATTATAAGAAAGG + Intronic
1093541235 12:20287845-20287867 CTCACTCATTACTGCAAGAAGGG + Intergenic
1095542959 12:43331701-43331723 CTCATTCATTTATATAAGCAAGG - Intergenic
1096383621 12:51179860-51179882 TTCACTCACCCCTACAAGAAAGG + Intergenic
1097607944 12:61778910-61778932 CCCACTAGTCTCTATAAGCAAGG - Intronic
1097615349 12:61878928-61878950 CTCCCTCATCTCTGCAAGAGGGG - Intronic
1098067453 12:66633804-66633826 TTCACTCATCTCTATTGGCAAGG + Intronic
1098198723 12:68031830-68031852 CTCACTAATATCTATATGAAGGG + Intergenic
1099578630 12:84411885-84411907 CTAACTCATCTATATCAGATGGG - Intergenic
1100039133 12:90291149-90291171 CTCACTCATTACCATAAGAAGGG + Intergenic
1100051559 12:90455382-90455404 ATCACTCATCTCTGTTAGGATGG - Intergenic
1101382238 12:104224145-104224167 CTCACTCATCTGTTCATGAATGG + Intronic
1104302328 12:127575711-127575733 CTCTCTCATCTCTAAGAAAAGGG + Intergenic
1104337970 12:127918356-127918378 CTCACTCATCGCCAAAGGAATGG - Intergenic
1106559799 13:30838405-30838427 CTCACTCATTACTACAAGGAGGG + Intergenic
1106638991 13:31563160-31563182 CTCACCCATTTATCTAAGAATGG + Intergenic
1108878612 13:55080816-55080838 ATCACTCATCTCTATTTGAATGG - Intergenic
1109067882 13:57723648-57723670 CACAATCATTTATATAAGAAAGG + Intronic
1109079102 13:57875419-57875441 CTCACTCATTTCCATAAGGATGG + Intergenic
1109339778 13:61041170-61041192 CTCAGTTATCTTTATGAGAAAGG - Intergenic
1109901937 13:68784932-68784954 CTCACTCATGACCACAAGAATGG - Intergenic
1109906135 13:68844868-68844890 CTCACTCACTTTTACAAGAAAGG - Intergenic
1111290693 13:86166273-86166295 CTCACTCATATCCAGAAGACTGG + Intergenic
1112792490 13:103017747-103017769 CTCACTCAGCTCTCTTAAAATGG + Intergenic
1113184348 13:107670439-107670461 ATCACTGATTTCCATAAGAAAGG - Intronic
1113619490 13:111703312-111703334 CACGCGCATCTGTATAAGAAAGG + Intergenic
1113625019 13:111788573-111788595 CACGCGCATCTGTATAAGAAAGG + Intergenic
1115841255 14:37473124-37473146 CTCACTCATTACCATGAGAAAGG - Intronic
1117865204 14:60141018-60141040 CTCTTTCATCTTTATAAGTAGGG - Exonic
1120585465 14:86306977-86306999 CTCTGTCATCTCTATTATAAGGG - Intergenic
1120587492 14:86331421-86331443 TTCACGCCTCTCTTTAAGAATGG - Intergenic
1120763506 14:88307021-88307043 CACACCCATCTCTATAGAAATGG + Intronic
1121211198 14:92209128-92209150 CTCCCTCATCTCTGTAGGTACGG + Intergenic
1121260063 14:92559486-92559508 CTCACCCATCTTTATAAACATGG - Intronic
1121485426 14:94310833-94310855 CTCAGTCATCACTTTAAGACTGG - Intronic
1121981851 14:98461220-98461242 CTCCCTCATCACTATAGGGATGG - Intergenic
1123196829 14:106625083-106625105 CTTACTCATTTGTATAATAATGG + Intergenic
1123775556 15:23575630-23575652 CTCACTCATCTCTGCAAGAATGG - Intronic
1127623257 15:60754744-60754766 TTTCCTCATCTGTATAAGAAAGG - Intronic
1130173363 15:81540970-81540992 TTCACTCATTACTACAAGAATGG - Intergenic
1135653518 16:24227629-24227651 CTCTCTCATCTCCACAAGGATGG - Intergenic
1137494547 16:48959629-48959651 CTCCCACATCTCTATCAGACAGG - Intergenic
1145096544 17:20033678-20033700 CTCACTCATTCCTGCAAGAATGG + Intronic
1146126327 17:30234429-30234451 CTCACTCATCCATATTGGAACGG + Intronic
1146701044 17:34960738-34960760 CTCACTCTTGTCTATAGAAAAGG + Intronic
1150496300 17:65610448-65610470 CTCACTCATTAGCATAAGAACGG + Intronic
1151069278 17:71189787-71189809 CTCACTCACCGTCATAAGAACGG + Intergenic
1151212577 17:72555567-72555589 CTCACTCATTTATATCAGTATGG - Intergenic
1153109315 18:1564958-1564980 CTCACTCATTACCATAAGGATGG - Intergenic
1155449349 18:25947083-25947105 GGGACTCATCTCCATAAGAAGGG + Intergenic
1156104283 18:33638729-33638751 CTCAGTCATGTCTATAAAACTGG + Intronic
1156201257 18:34834731-34834753 CTCACTCATTGCTGTGAGAATGG + Intronic
1159262014 18:66026317-66026339 CTCACTCATTCCCATGAGAATGG - Intergenic
1160020190 18:75174418-75174440 TTCACTCATCTCAAGAAGAAAGG - Intergenic
1160576863 18:79860649-79860671 CACACACATCACTATGAGAATGG - Intergenic
1160673828 19:378155-378177 CTAACTCATCTCTTTGTGAAAGG - Intergenic
1161377196 19:3946043-3946065 CTCTCTGAGCCCTATAAGAATGG - Intergenic
1162846840 19:13399350-13399372 CTGACTCATCTCTCTGAGCAAGG - Intronic
1164088753 19:21928963-21928985 CTCAATCCCCTCTATAAGCAAGG - Intergenic
1164191790 19:22924658-22924680 CTCAATCCCCTCTATAAGTAAGG - Intergenic
1164710880 19:30356403-30356425 CTCACTCATCTGTACCAGGACGG - Intronic
1164940980 19:32252101-32252123 CTCACTCATGACCATAGGAAAGG - Intergenic
1165076536 19:33282664-33282686 CTCACTCTTGCCTAAAAGAACGG - Intergenic
925740741 2:7004041-7004063 CTTTCTCATCTCTGAAAGAAAGG + Intronic
925869631 2:8258056-8258078 CTAACTCTTCTCTAGAGGAAAGG - Intergenic
925875942 2:8311304-8311326 CTCATTCATCTCTAGAATAGAGG - Intergenic
926772430 2:16390424-16390446 CTCAGTCATCTGTATCAGGAGGG + Intergenic
927113935 2:19883879-19883901 CTCACTCAGCTCTGGAGGAAAGG - Intergenic
927322577 2:21764693-21764715 TTGAGTCATCTCTATAAAAATGG - Intergenic
928870471 2:35971535-35971557 CTCAGGCATCTCTTTAACAAAGG - Intergenic
929970402 2:46569443-46569465 CTTCCTCATCTCTAAAAGCAGGG - Intronic
931482835 2:62659560-62659582 TTTACTCATCTATAGAAGAAAGG - Intergenic
933275184 2:80276753-80276775 CTCACTCAATTCCATGAGAATGG + Intronic
933765070 2:85701653-85701675 CTCACTCATTACCACAAGAATGG - Intergenic
933894442 2:86797923-86797945 CTCTCTCAGCTCCATAGGAAAGG - Intronic
933978165 2:87528560-87528582 CACGGTCATCTCTAAAAGAAAGG + Intergenic
934818629 2:97352713-97352735 CTCACTGCTCTCTCTGAGAAAGG - Intergenic
936315669 2:111422243-111422265 CACGGTCATCTCTAAAAGAAAGG - Intergenic
936469178 2:112783290-112783312 CTCACTCAGATGTAGAAGAAAGG - Intronic
936547320 2:113403936-113403958 CTCACTGCTCTCTCTGAGAAAGG - Intergenic
936950391 2:117972267-117972289 TTCACTCTTTTCTAGAAGAATGG + Intronic
937652477 2:124336025-124336047 CTCCCTCATCCCTATAAGGAGGG - Intronic
937739014 2:125326936-125326958 CTCTCTCTTCTCTCTAGGAAGGG + Intergenic
937875940 2:126825372-126825394 CTCACTCATCGCCATGAGGAGGG - Intergenic
939463373 2:142526590-142526612 CTCACTCACTACCATAAGAATGG - Intergenic
939607250 2:144268117-144268139 CTCACTCATTACCATGAGAATGG - Intronic
940496761 2:154439257-154439279 CTCCCTCTTCTCTGTCAGAAAGG - Intronic
941152705 2:161934635-161934657 CTACCTCACATCTATAAGAATGG - Intronic
941834744 2:170004194-170004216 CTTACTCATGTCTATGAAAATGG + Intronic
942137970 2:172947713-172947735 ATGACTCATCTGTATAAGAGAGG + Intronic
942225851 2:173815366-173815388 CACAATCATCACAATAAGAAGGG - Intergenic
942710556 2:178830421-178830443 TTGACTCCTGTCTATAAGAAGGG + Exonic
943204453 2:184875336-184875358 CTCACTCATTGCCATGAGAATGG - Intronic
943769558 2:191701796-191701818 CTCACTCATTTCCACAAGGACGG - Intergenic
943857852 2:192821505-192821527 CTCACTCATTACTGTGAGAATGG - Intergenic
943874187 2:193041362-193041384 ATGACTTATCTCTATAATAAGGG - Intergenic
945306573 2:208265077-208265099 CTCCCTCATCTCTCTGAGGAAGG - Intronic
947618214 2:231572078-231572100 CCCACTCATCTCTAAAACAAAGG - Intergenic
947938235 2:234025738-234025760 TTCACTCATCTCTGAAAAAAAGG - Intergenic
948975192 2:241459519-241459541 CTCACAAATCTCTATTAAAAAGG - Intronic
1169352632 20:4881395-4881417 CTCACTCTTATCTCTAAGTATGG - Intronic
1170116111 20:12861644-12861666 CTCACACATCTTTATAGAAAAGG - Intergenic
1170495121 20:16916362-16916384 CTCACTGATTACCATAAGAATGG + Intergenic
1170685081 20:18562521-18562543 CTCACTCATTTCTGTGAGGATGG - Intergenic
1170806175 20:19633839-19633861 CTCACACAACTCCTTAAGAAGGG - Intronic
1171470235 20:25364504-25364526 CTCACTCATTCCCATAAGAGTGG + Intronic
1172636049 20:36410704-36410726 TTCACTCATCACTATGGGAATGG + Intronic
1174769177 20:53282369-53282391 CTCACTGATCTGCATATGAAAGG - Intronic
1176110667 20:63409376-63409398 GTCACTCATGACAATAAGAAGGG + Intronic
1176251337 20:64121887-64121909 CTCACTCATCACCATGAGGAGGG + Intergenic
1176636592 21:9249489-9249511 CACACTCATATCCAAAAGAAAGG - Intergenic
1178110678 21:29367052-29367074 CTCACTCATCCCCACAAGAATGG - Intronic
1178794017 21:35726850-35726872 CAAACTCATTTCTATTAGAAAGG - Intronic
1178999281 21:37440501-37440523 ATTAATCATCTCTATTAGAAAGG - Intronic
1183038647 22:35159688-35159710 CCAGCTCATCTCTGTAAGAATGG + Intergenic
1184361177 22:44019735-44019757 CTCACTCATTACTATGAGGATGG + Intronic
949153765 3:803144-803166 CTCACTCATTACTGTAGGAAGGG + Intergenic
949612155 3:5714109-5714131 CTCACTCATTACCATAAGGATGG - Intergenic
949639340 3:6017368-6017390 CTCTCTCATCTGTATAATCATGG + Intergenic
949820400 3:8109944-8109966 TTCACTCAACTCTATGAGATAGG - Intergenic
951989483 3:28660589-28660611 ATCATTCATGTCTGTAAGAATGG + Intergenic
952682874 3:36116114-36116136 CTCAAACAACTCTATAGGAAAGG + Intergenic
953007305 3:38990287-38990309 CTCACTCACCTCTGCAATAAGGG + Intergenic
955889961 3:63639567-63639589 ATCACTCATAACTATCAGAATGG + Intergenic
956374158 3:68596253-68596275 CTCACAAATCTCTATAGGACAGG - Intergenic
957496472 3:80997797-80997819 CTAACTCAACTCTAGAAGTATGG - Intergenic
959274477 3:104260660-104260682 CTCACTCATTACCAGAAGAATGG - Intergenic
959767483 3:110048823-110048845 CTCACTCATTTTTAAAAAAATGG + Intergenic
960728525 3:120697350-120697372 CACAATCAACTCTATAAGACAGG - Intronic
961316162 3:126037111-126037133 TTCACTCATTACTATGAGAAGGG - Intronic
962141362 3:132793961-132793983 CTCACTCATTACCATAAGGAGGG + Intergenic
963583791 3:147159411-147159433 CTCACTCACTACTATGAGAAGGG + Intergenic
965485173 3:169270127-169270149 CTCACTGATCCCGGTAAGAAAGG + Intronic
965532244 3:169783233-169783255 CCAAATCATCTCTATTAGAAGGG + Intronic
966052476 3:175637516-175637538 CTCACTTATTTCTTTGAGAATGG - Intronic
966367854 3:179210081-179210103 AACAATCATCTCTATAATAATGG - Intronic
969984161 4:11189859-11189881 CTCACTCATCTCTTCATTAATGG + Intergenic
970125655 4:12807020-12807042 CTCACTCATTGCTATGAGGAAGG + Intergenic
970275135 4:14391614-14391636 CTCACTCAGCTCTGTAATATAGG + Intergenic
970526453 4:16937361-16937383 TTTACCCATCTCTTTAAGAAGGG + Intergenic
970793017 4:19881281-19881303 CTCACTCATCTTTAGAATACTGG + Intergenic
970893994 4:21080272-21080294 TTAACTCATCCCTATAAGGATGG - Intronic
970993855 4:22242968-22242990 CTATCTCATATCAATAAGAATGG - Intergenic
971141039 4:23924904-23924926 ATCACTCTTCTATAAAAGAAAGG - Intergenic
971862845 4:32130474-32130496 AGCACTCATCTCTATCAGTAAGG + Intergenic
973062312 4:45742774-45742796 CTTACTCACCTGTATAAGATTGG + Intergenic
973139015 4:46743036-46743058 CTTACTCATAGCTATCAGAAAGG - Intronic
977459846 4:97311310-97311332 ATCACTAATGCCTATAAGAATGG - Intronic
977935801 4:102803398-102803420 CTGACTCCCCTCTATTAGAAAGG + Intronic
980604256 4:135068308-135068330 CTTACTGCTCTCTATAAGCACGG + Intergenic
981918470 4:150060610-150060632 CTCACTCATTCCTGTAATAAGGG + Intergenic
982141498 4:152324581-152324603 CTCACACACTTCTATCAGAAAGG + Intronic
982635706 4:157894272-157894294 CCCACTGGTCACTATAAGAAAGG - Intergenic
986628645 5:9747569-9747591 CTCACTCATTACCATAAGGATGG + Intergenic
987357916 5:17081321-17081343 CTCGCTCCCCTCTGTAAGAAAGG - Intronic
988250464 5:28750870-28750892 CTCACTCATTCCTGTGAGAATGG - Intergenic
988671561 5:33387216-33387238 CTCACTCATTACTGTGAGAAGGG + Intergenic
989389691 5:40887001-40887023 CTCACTTATTACTACAAGAAGGG - Intergenic
990716128 5:58639179-58639201 CTCACTCATTTCAATGAGCAAGG - Intronic
990904600 5:60790652-60790674 ATCTCTCATCTCTATAGCAAAGG + Intronic
993446615 5:88020492-88020514 CTCACTCATCACCATGGGAAGGG + Intergenic
995007406 5:107216718-107216740 CTCACTCATCACTGTAAGGATGG - Intergenic
996042271 5:118828534-118828556 CGCACTCATCTCTTTAAGAGAGG + Intergenic
997109464 5:131059016-131059038 CTCACTCATCTGCAAAATAATGG + Intergenic
997841896 5:137248663-137248685 CTCACTCATCTCTATCTGTGCGG - Intronic
1000269614 5:159671547-159671569 CTCACTCATTACTATGAGGAGGG - Intergenic
1001276818 5:170357292-170357314 CTCATTCAACCCCATAAGAAGGG - Intronic
1001927475 5:175649083-175649105 CTCACTCATCACCAAAAGGATGG + Intergenic
1004341967 6:14815771-14815793 ATCTCTCATCTATACAAGAAAGG - Intergenic
1004346403 6:14853218-14853240 CACACTAATTTCTATAATAAAGG + Intergenic
1004703904 6:18104918-18104940 CTCACTCATTACTGTGAGAATGG + Intergenic
1007230813 6:40346470-40346492 CTCACTCATTACCACAAGAAGGG - Intergenic
1007384301 6:41510346-41510368 CCCACCCATCTCTGTAGGAAGGG + Intergenic
1011220841 6:85053000-85053022 CTCACTCATTACTGTAAGGATGG + Intergenic
1011401855 6:86971388-86971410 CTCTCTAAACTCTAAAAGAAAGG + Intronic
1011944842 6:92888153-92888175 CCCACTCCTATCTATCAGAAGGG - Intergenic
1012029048 6:94035712-94035734 CTAACTCATCACTTTAAGAAGGG - Intergenic
1014786151 6:125621818-125621840 CTCATTCCTCTCTAGAAGCAGGG - Intergenic
1014918384 6:127182167-127182189 CTCACTCATTACCATGAGAATGG + Intronic
1016533603 6:145086422-145086444 CTCACTCACTCCCATAAGAATGG + Intergenic
1016563224 6:145420906-145420928 CTAACTCATTTCTACAATAATGG + Intergenic
1016583872 6:145661849-145661871 ATCACTGATCTCTATCATAATGG + Intronic
1016627326 6:146186863-146186885 CTAACTCAACTGTCTAAGAAGGG + Intronic
1016630302 6:146221820-146221842 CTCACTCATTTGTATACAAATGG - Intronic
1017231164 6:152075535-152075557 CCCACTCATCTCTCAAAGAGAGG + Intronic
1018445531 6:163854766-163854788 CTCACCAATCTTTAAAAGAAAGG - Intergenic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1020343405 7:7137097-7137119 ATCACTGAACTCTATAAGAAAGG + Intergenic
1020746736 7:12088945-12088967 CTCACTCATCCCTCACAGAAGGG - Intergenic
1022371752 7:29777828-29777850 CTTCCTCTTCTCTTTAAGAAGGG - Intergenic
1022958215 7:35400881-35400903 CTCACTCATCTTTTTAAATAAGG + Intergenic
1025986436 7:66456877-66456899 ATCACTCAAATCTATTAGAATGG + Intergenic
1026041154 7:66869214-66869236 CTCACTACTTTCCATAAGAATGG - Intergenic
1026454182 7:70556370-70556392 ATCACTCATCTAGAAAAGAAGGG + Intronic
1026554470 7:71394292-71394314 CTCACTGAATTCCATAAGAATGG + Intronic
1028482246 7:91320389-91320411 CTTACTCAGCTCTTTAAGAAGGG - Intergenic
1028881716 7:95887583-95887605 CTCACCCTTCTCTATGAGCAAGG + Intronic
1032010846 7:128346830-128346852 CTCACTCCTCTCTCAAACAAGGG - Intergenic
1032348731 7:131140473-131140495 CTCACTCATCACAGCAAGAAAGG - Intronic
1033774943 7:144598879-144598901 GTCACTCATCTGTAAAGGAAGGG + Intronic
1033904718 7:146188236-146188258 CTCACTCACATCAAGAAGAATGG - Intronic
1034279813 7:149845189-149845211 CTCACTCATCTCTAAGACGATGG - Intronic
1035722879 8:1805337-1805359 CTCACTCACCTGTACAAGGAAGG + Intergenic
1038044037 8:23750892-23750914 CTGAGTCAGCTCTATAGGAATGG + Intergenic
1038743945 8:30239621-30239643 CTCACTCATCGCCATGGGAATGG + Intergenic
1039889916 8:41678658-41678680 CACATTCATCTCTAGAAGATTGG + Intronic
1040628851 8:49184942-49184964 CTCACTCATCACTGTGAGGAGGG - Intergenic
1040651769 8:49457084-49457106 CTGACTCATCTCCATGGGAAGGG - Intergenic
1042030592 8:64471712-64471734 CTCACTCATCACCATGAGGATGG + Intergenic
1042723747 8:71850270-71850292 CCGACTCATCTATAAAAGAAGGG + Intronic
1044071176 8:87762014-87762036 CTCACCCTGCTCTTTAAGAAAGG - Intergenic
1044580389 8:93820269-93820291 CTCACTCATCACTACATAAAAGG + Intergenic
1045794100 8:106022917-106022939 CTGATTAATCTCAATAAGAAGGG - Intergenic
1046565201 8:115890704-115890726 CTAACTCGTCTCTGAAAGAATGG + Intergenic
1047348619 8:124052392-124052414 GTCACTGATCTCTTTAGGAAGGG - Intronic
1047517130 8:125564690-125564712 CTCACTCATCTCTATATCCCTGG + Intergenic
1048058650 8:130894309-130894331 CACACACATTTCTATAAGAATGG + Intronic
1048060640 8:130916303-130916325 CAAACTCAGATCTATAAGAAGGG - Intronic
1049124828 8:140777414-140777436 CTCACTCATCACCAAAGGAACGG + Intronic
1049906169 9:218886-218908 CTCATTCACCTCTATGAGATAGG + Intronic
1050107040 9:2176440-2176462 TTCACTCAGCTCAATAAGAAAGG - Intronic
1050727537 9:8669054-8669076 CTCTCTCCTCTCTATGGGAAAGG + Intronic
1052392351 9:27894977-27894999 CAGACTCATCTCTCTAAGAGCGG - Intergenic
1055495554 9:76851087-76851109 CTCACATATCTTTATAAGATTGG + Intronic
1055782530 9:79834811-79834833 CTCATTCATTTCCATGAGAATGG + Intergenic
1060057500 9:120427394-120427416 CACAAACATCTCTATAAGACAGG + Intronic
1060066802 9:120509134-120509156 CTGATTGATCCCTATAAGAAGGG - Intronic
1061483451 9:130908628-130908650 CTTCCTCATCTCTAAAAGGAGGG + Intronic
1185596614 X:1310893-1310915 CTCACTCATTACTACAAGAAAGG - Intergenic
1185810507 X:3104839-3104861 CTCACTCATCTCTATAAGAAAGG + Intronic
1186596426 X:10986536-10986558 CTCACTCATCTGTAAAAATAGGG + Intergenic
1186766836 X:12779205-12779227 CTCACTCTTCTCTATTGGATAGG - Intergenic
1187470638 X:19566485-19566507 CTCCCTCATGTCAATAGGAAGGG - Intronic
1188095534 X:26016823-26016845 CTCACTCATTACCATGAGAAGGG + Intergenic
1189135838 X:38548679-38548701 CTCATGCATTTCAATAAGAAGGG + Intronic
1194476836 X:94369100-94369122 CTCACTCTTCCCCAGAAGAAAGG - Intergenic
1194529791 X:95031855-95031877 CTCACTCACTCCCATAAGAATGG - Intergenic
1194567510 X:95510646-95510668 ATCACTCAGCTTTAAAAGAAAGG + Intergenic
1194962217 X:100248782-100248804 CTTTCTGCTCTCTATAAGAAGGG + Intergenic
1195412457 X:104582893-104582915 CTCCATCATCTCAATAAGAAAGG - Intronic
1195509063 X:105693357-105693379 CTCACTCATTACTATGAGGATGG - Intronic
1195604191 X:106783894-106783916 CTCACTCATTACCATAAGGATGG + Intronic
1196561316 X:117152564-117152586 TTCACATATCTCTGTAAGAATGG + Intergenic
1196989463 X:121312093-121312115 CACACTCTTCTCTATAGGGAGGG + Intergenic
1197001409 X:121443771-121443793 CTCACTCATTACTTTGAGAATGG + Intergenic
1198010807 X:132551763-132551785 CTCACTCATTACTATGAGGAGGG - Intergenic
1198999830 X:142622147-142622169 CTTACTGATCTCTAAAAGAAAGG - Intergenic
1199501011 X:148505450-148505472 CTCATTCATGTCTATAATGATGG - Intronic
1199504049 X:148541867-148541889 TTCACTCATCTGTATAACAGAGG - Intronic
1199785056 X:151097923-151097945 CTCACTAATCTCTACAAGGAAGG - Intergenic
1200334649 X:155336748-155336770 CTCACTCATTACTATGAGAGTGG + Intergenic
1200351817 X:155504473-155504495 CTCACTCATTACTATGAGAGTGG - Intronic
1201252936 Y:12078778-12078800 CTCATTCATATCTAGAAGACAGG - Intergenic