ID: 1185815592

View in Genome Browser
Species Human (GRCh38)
Location X:3152190-3152212
Sequence ATGGAACCACTGATGGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185815592_1185815599 23 Left 1185815592 X:3152190-3152212 CCAAATTCCATCAGTGGTTCCAT No data
Right 1185815599 X:3152236-3152258 CAGACAGCAGAGTACCATTCAGG No data
1185815592_1185815595 -5 Left 1185815592 X:3152190-3152212 CCAAATTCCATCAGTGGTTCCAT No data
Right 1185815595 X:3152208-3152230 TCCATGAATAAACAGAACGTGGG No data
1185815592_1185815601 25 Left 1185815592 X:3152190-3152212 CCAAATTCCATCAGTGGTTCCAT No data
Right 1185815601 X:3152238-3152260 GACAGCAGAGTACCATTCAGGGG No data
1185815592_1185815602 29 Left 1185815592 X:3152190-3152212 CCAAATTCCATCAGTGGTTCCAT No data
Right 1185815602 X:3152242-3152264 GCAGAGTACCATTCAGGGGCTGG No data
1185815592_1185815603 30 Left 1185815592 X:3152190-3152212 CCAAATTCCATCAGTGGTTCCAT No data
Right 1185815603 X:3152243-3152265 CAGAGTACCATTCAGGGGCTGGG No data
1185815592_1185815594 -6 Left 1185815592 X:3152190-3152212 CCAAATTCCATCAGTGGTTCCAT No data
Right 1185815594 X:3152207-3152229 TTCCATGAATAAACAGAACGTGG No data
1185815592_1185815600 24 Left 1185815592 X:3152190-3152212 CCAAATTCCATCAGTGGTTCCAT No data
Right 1185815600 X:3152237-3152259 AGACAGCAGAGTACCATTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185815592 Original CRISPR ATGGAACCACTGATGGAATT TGG (reversed) Intergenic
No off target data available for this crispr